Как правильно распотрошить утку: Жизнь охотника. Как разделать утку на охоте?

Разное

Содержание

Жизнь охотника. Как разделать утку на охоте?

Как разделать утку на охоте? Такой вопрос может возникнуть, если охота на уток длится несколько дней, а домой ехать рано, поэтому тушку нужно обработать прямо на охоте.

Иногда обработка и разделка утки понадобится, когда охотники планируют приготовить одно из блюд прямо на природе.

Нет ничего сложного в этом процессе, поскольку разделка дикой утки происходит по тому же сценарию, что и домашней.

Если добытую тушку утки нужно использовать для приготовления какого-нибудь блюда на охоте, то её предварительно следует ощипать.

Как ощипать дикую утку?

Процесс ощипывания многими людьми воспринимается неохотно, поскольку является нудным и долгим процессом.

Существует два наиболее распространённых метода ощипывания дикой утки: метод сухого ощипывания и метод ошпаривания.

Ощипывание методом ошпаривания, когда тушка утки заливается кипятком и оставляется в нём на несколько минут, в основном не применяется на охоте.

Сухое ощипывание – это то, что постоянно применяется охотниками, чтобы освободить утку от пуха и перьев.

Начинать его следует со спины. Потом выдернуть перья на крыльях и в хвосте, а затем плавно перейти на грудь, где находится много пуха.

Если Вы положите утку на колени так, чтобы голова висела вниз, то так будет удобнее её ощипывать. Последовательность ощипывания не так важна, поэтому можете её проводить на свой взгляд.

Удаляйте перья и пух аккуратно, чтобы не повредить кожу. После удаления всех перьев тушку нужно опалить на огне.

Если костёр коптит или сама утка влажная, то её лучше предварительно натереть мукой и уже потом начать опаливать.

Таким образом, мука поглотит в себя всю влагу и те волоски, которые остались после ощипывания. Они отделятся от кожи и сгорят.

В качестве огня можно использовать сухое горючее, которое следует брать на охоту всегда, ведь оно горит практически в любую погоду, поэтому Вы всегда будите с огнём.

После ощипывания и опаливания нужно приступать к самому процессу разделки тушки, который заключается в отделении самого мяса от внутренних органов птицы.

Если дикая утка обрабатывается в домашних условиях, то её перед самой разделкой замачивают в воде в течение нескольких часов, которую за всё это время один раз нужно поменять обязательно. Весь болотный запах птицы исчезнет.

Перед разделкой нужно отрезать утке голову, крылья, лапки и разрезать брюхо. Крылья следует отрезать на первом суставе, а лапки на расстоянии в 2 сантиметра от сустава пятки.

Через разрез на брюшке удалите кишечник и все остальные кишки вместе с легкими, печенью, желудком и сердцем.

После этого хорошо промойте тушку в холодной воде и приступайте к приготовлению блюда из дикой утки, поскольку она полностью к этому готова.

Теперь Вы уже знаете, как разделать утку на охоте.

Как ощипать утку в домашних условиях

Любая женщина должна владеть элементарными навыками приготовления пищи. Одним из таких навыков является ощипывание и разделывание домашней птицы. Эта статья расскажет о различных способах ощипывания уток. А также о том, как их правильно разделывать.

Содержание материала

Забой уток

Молодых утят забивают обычно в двухмесячном возрасте, перед началом их линьки. Оптимальным временем для забоя считается период до наступления заморозков, чтобы не было пеньков. Или не более недели после первых холодов, когда утки начинают терять вес. Примерно за полторы недели до этого из утиного рациона должен быть исключён рыбий жир. Сутки до убоя желательно не кормить, а за 2– 3 часа и не поить домашних птиц.

Утка очень живучая птица. Поэтому при забое (острым ножом) нужно удерживать ноги и крылья, стремясь перерезать не только горло, но и все кровеносные сосуды, которые находятся у самой головы. Хотя одним точным ударом острого и тяжёлого топора это делается быстро и без лишних мучений для птицы. После чего утку нужно подержать несколько минут над специально приготовленной посудой, для того чтобы стекла кровь. Далее, ошпарить тушку кипятком, дать остыть, не допуская при этом полного охлаждения, и ощипать.

Необходимые знания перед ощипыванием утки

По возможности утку нужно ощипывать не сразу, а спустя несколько часов после забоя. Это делается для затвердевания жира, чтобы избежать разрывов её кожи при ощипывании.

Процесс ощипывания нужно начинать с крупных перьев (крылья, хвост), а потом удалять и более мелкие пёрышки. Крупные перья вырываются по направлению их роста, чтобы избежать различных повреждений кожного покрова. Мелкие можно ощипать в любом направлении. Незначительный оставшийся пушок может быть убран при помощи тупого ножа или опаливания.

Методы ощипывания уток и индоуток

Сухое ощипывание

  • Этим простым и незатейливым способом часто пользуются охотники. Для этого нужно расстелить на сухую поверхность покрывало или любую газету, чтобы на ней ощипать нашу утку. Начинаем, как и положено с крупного оперения крыльев и хвостовой части, ощипывая по направлению их роста переходим постепенно к спине.
  • Очищаем от перьев грудь и шею утки. Осторожно производим очищение от мелких пёрышек, чтобы избежать повреждения кожи.
  • На последнем этапе ощипывания удаляем оставшийся небольшой пушок, при помощи тупого ножа или просто опалив утку на костре, если вы находитесь на отдыхе или на охоте.
  • Если вам нужно опаливать птицу в домашних условиях, то вам понадобится обычная горелка. Немного обсыпьте утку мукой, которая хорошо способствует поглощению влаги и держите её над пламенем несколько минут, но не переусердствуйте, во избежание сгорания кожи. Эта процедура избавит тушку от остатков маленьких пёрышек и пеньки, которые легко отделятся или сгорят. Чтобы удалить копоть от опаливания промойте утку водой.

Сухой метод ощипывания не только прост, но и практичен. После него ощипанную тушку можно долго хранить в морозильной камере.

Горячее ощипывание уток

Горячий метод (ошпаривание) широко применяется многими птицеводами. Следует обратить внимание, что процесс ошпаривания начинается только после определённой выдержки тушки (3–4 часа). А уже по истечении этого времени следует приступать к данному процессу. Основные этапы ошпаривания.

  1. В большой ёмкости (кастрюле или котле) нужно нагреть воду примерно до 80 градусов. Не доводите её до кипения, чтобы не перегреть утиную кожицу. Иначе качественно и быстро ощипать её не получится.
  2. Ошпарить утку можно и с помощью утюга и холщового мешка. Для этого на четверть часа замочите мешок в ёмкости с горячей водой. После этой процедуры хорошо его выжмите. Далее, заверните птицу в мешок и горячим утюгом аккуратно проглаживайте его 10 минут. Это нужно для хорошего сохранения пера, и при необходимости, для дальнейшего его использования по назначению (например, набивки подушек, перин и т. п.).
  3. Ошпарить непосредственно саму тушку (не более одной минуты). Постарайтесь попасть на все перья. Удаление перьев производится против направления их роста. Нужно начинать с крыльев и дальше к хвосту. После чего ощипать спину, шею и грудку утки.
  4. Заключительным этапом горячего метода ощипывания (как и в случае сухого метода) является опаливание птицы для удаления мелкого пушка на кожном покрове. После чего тщательно промываем её водой, удаляя всю копоть.

Как быстро ощипать дикую утку без ошпаривания

Если не позволяют условия и нет горячей воды,

быстро ощипать дикую утку (когда в лесу и на охоте) можно и без ошпаривания. Для этого нужно надрезать её в области грудной клетки и снять перья со шкуркой. Это, конечно, сэкономит ваше время, но похрустеть зажаренной корочкой уже не получиться.

Как быстро ощипать утку с помощью специальной насадки для шуруповёрта

С помощью специальной насадки для шуруповёрта можно в течение 10 минут справиться с этой задачей. Для этого нужно присоединить скотчем шуруповёрт с насадкой к подходящему по высоте пеньку (насадка должна выступать за пределы пенька). Забитую и сухую птицу подносят к включённой насадке и осторожно ощипывают её: начиная с грудки, затем по всему телу, и заканчивая крыльями. После этой процедуры удаляют оставшиеся пёрышки руками и тупым ножом.

Правильное сохранение утиных перьев и пуха

После сухого ощипывания уток выброс перьев и пуха от них будет большим расточительством. Поскольку пух от домашней птицы является ценным наполнителем для подушек, одеял и даже пуховиков. Он прослужит в этом качестве много лет, хорошо сохраняя тепло. Пучки из перьев утки могут быть использованы для смазки домашних хлебных изделий. Выпечка от этого становится намного вкуснее.

Для долгого хранения перьев и пуха их замачивают в тёплом и мыльном растворе воды на несколько часов, чтобы ушла вся грязь, а также жир и ненужные запахи. Затем их хорошо промывают прохладной водой и тщательно отжав, кладут в мешок и вывешивают на просушку. Лучший вариант — это солнечные ванны и периодическое встряхивание, чтобы пух и перья не гнили.

Как распотрошить утку

После ощипывания и опаливания можно сразу распотрошить и разделать утку. Многие начинающие повара, положив, тушку на стол не знают с чего лучше начать и как разделывать утку. Необходимые знания, которые вы почерпнёте из этой статьи помогут вам в этом.

  • Острым ножом отрежьте кончики крыльев. Следом за этим по суставу надламываем и обрезаем ножки. Далее, делаем поперечный надрез в районе гортани и извлекаем трахею. Затем делаем разрез в нижней части брюха (в месте, где заканчивается костная основа). Делайте это аккуратно, чтобы не порезать стенки кишок и вынуть все внутренности, сохранив их целостность.
  • Соответственно, вслед за этим вынимаются кишки, желудок, печень, пищевод и сердце. А также в процессе отделяется лишний жир, который потом пригодится в домашнем хозяйстве (жарка картошки и т. п.). Распотрошённая таким способом утка промывается водой для удаления остатков крови.

Как правильно разделывать утку

При помощи кухонных ножниц для птицы вы легко справитесь с разделкой утиной тушки. Для этого зафиксируйте её рукой, положив, на спинку и сделайте надрез ножницами, проходящий вдоль одной из сторон грудины (от брюха к шейному отделу). С помощью такого продольного надреза вы раскроете грудинную область утиной тушки. Затем сделайте ещё один надрез вдоль её позвоночника и отделите две получившиеся половины друг от друга. После чего нужно сделать надрезы в районе суставов и отделить крылья и ноги. А теперь смело можете приступать к основной части задуманных кулинарных фантазий, связанных с приготовлением утиного мяса.

Эти довольно бесхитростные методы ощипывания, потрошения и разделывания уток

, а также и других пернатых, наверняка пригодятся вам в жизни и домашнем быту.

Как ощипать утку в домашних условиях быстро и правильно (+видео)

Утиное мясо – продукт вкусный и питательный. Однако прежде чем его приготовить, необходимо провести ряд манипуляций в виде ощипывания перьев и правильной разделки тушки. Опытные фермеры уже знают как быстро и качественно ощипать утку, получив не только мясо, но и отличный пух. А вот начинающим птицеводам и домочадцам охотника статья поможет разобраться в этой не очень приятной, но необходимой процедуре.

Содержание статьи

Общие рекомендации

Подходящее время для забоя молодняка домашних уток подбирают не только по нагулу массы, но и по состоянию оперения. К этому времени у птиц должна закончиться ювенальная линька, и утки полностью покрываются пером. Как правило, это возраст около 3 месяцев для индоуток и 2-2,5 месяцев для пекинской породы. Взрослую птицу перед убоем также проверяют, выщипнув у нее несколько перьев.

Не рекомендуется производить забой уток во время линьки.

Если перо легко отделяется, то процесс ощипывания будет происходить намного легче и качественнее. Забивая поголовье во время линьки, можно значительно затруднить ощипывание, которое будет неравномерным. Чтобы получить мясо без пеньков в коже, следует отложить забой на неделю-другую, позволяя новым молодым перьям отрасти на достаточную длину. При невозможности выбора перо снимается вместе с кожей.

К ощипыванию приступают спустя 2-4 часа после убоя. За это время у птицы застынет подкожный жир, что позволит избежать при ощипывании разрывов кожи. Хотя при сухом способе щипки пера к процедуре можно приступать не откладывая.

[adsp-pro-4]

Ощипывание следует начинать с самых крупных маховых перьев, расположенных на хвосте и крыльях, которые удаляются по направлению их роста во избежание повреждений кожного покрова. Поочередно очищаются от пера спинка и грудь, шея и в завершение ноги утки.

Мелкие перышки можно выдергивать в любом направлении, но делать это аккуратно, особенно на нежных участках кожи, чтобы не порвать ее. Нужно стараться максимально очистить всю тушку, за исключением покрова на шее и голове. Рывки должны быть резкими и короткими. Перья захватываются небольшими пучками, что также убережет кожу от разрывов.

После ощипа тушку утки опаливают газовой горелкой.

Оставшийся пушок удаляют, зажав его между тупой стороной ножа и большим пальцем. Избежать разлетания легкого пуха поможет небольшое опрыскивание водой. Если перо птицы планируется использовать в дальнейшем, то при щипке целесообразно сразу сортировать его по разным емкостям.

Для полной очистки кожного покрова следует опалить тушку, воспользовавшись газовой горелкой. Для удаления лишней влаги утку предварительно натирают мукой. Расправляя кожные складки и крылья, огнем обрабатывается вся тушка. Для этого можно воспользоваться и пучком соломы, которая в отличие от горелки не оставит неприятного запаха, а наоборот, придаст аромат костра. В домашних условиях обжечь птицу можно над конфоркой газовой плиты или при помощи сухого спирта. Обработку пламенем проводят быстро, чтобы сберечь кожу и не расплавить жир.

Внимание. Перед опаливанием крупные перья должны быть удалены вручную во избежание возгорания тушки. Чтобы не получить случайных ожогов, лучше воспользоваться металлическими щипцами.

В завершение большим количеством воды смываются копоть и остатки муки, а тушка обтирается чистой тканью насухо.

Методы ощипывания утки

Способов ощипывания птицы несколько. Это сухой и горячие методы обработки. Ознакомившись со всеми вариантами, каждый хозяин выбирает по его предпочтению. Для длительного хранения мяса в морозильной камере подходит только сухой метод отделения пера, при горячих способах утку необходимо сразу же переработать в пищевой продукт.

После горячей обработки мясо меняет свой естественный цвет на красный, к тому же в этом случае использовать перо в качестве наполнителя для одежды и постельных принадлежностей уже не удастся. Необходимо соблюдать осторожность при работе с горячей водой, самой тушкой и утюгом во избежание ожогов. Преимуществом горячих способов ощипывания перед сухим является легкость отделения пера и отсутствие разлетающегося пуха.

Утку можно ощипать различными способами.

Сухой метод

Сухой метод самый простой и распространенный. К ощипыванию можно приступать сразу же после забоя, пока тушка теплая. Так считают охотники, пользующиеся этим приемом для обработки дичи.

[adsp-pro-5]

В качестве необходимого инвентаря понадобятся глубокая тара для пуха и емкость с водой для смачивания, чтобы избежать его разлетания в воздухе.

Основные этапы:

  1. Перед собой нужно разложить покрывало, простыню или газеты и сесть, расположив тушку между колен вниз головой.
  2. Одной рукой придерживая кожу, другой делаются резкие, но аккуратные рывки. Если кожа порвется, то дальнейшее выдергивание пера станет затруднительным.
  3. Также пригодится неострый нож, с помощью которого дощипываются невызревшие короткие перья.
  4. Неудаленные механическим путем пух и перышки уничтожаются опаливанием.
  5. Промытая утка готова к потрошению.

Горячий способ ошпаривания

Способ также нередко используется птицеводами. Кому-то он может показаться сложнее предыдущего, однако при необходимой сноровке все получается легко и быстро. Для его выполнения понадобятся большая кастрюля или таз, в которую полностью помещается утка. Можно дополнительно воспользоваться чайником.

При горячем способе тушку утки сначала ошпаривают в воде.

Последовательность процедуры:

  1. Подогреть в кастрюле воду до 80 градусов. Вода не должна кипеть, т.к. от кипятка может лопнуть кожа, и ощипать перья уже не удастся. Температура ниже указанной не даст необходимого эффекта.
  2. Опустить тушку в воду. Молодую птицу держат в емкости от 1 до 5 минут. Тушки старых птиц можно держать до 10-15 минут. Более долгая обработка чревата тем, что кожа может свариться и впоследствии снимется вместе с перьями.
  3. В другом варианте можно заливать утку подогретой водой из чайника, стараясь попадать на все перья и оставить ее в кастрюле на 15 минут.
  4. Ошпаренную тушку вынимают из воды и сразу приступают к ощипыванию, подвесив ее за лапы для удобства обработки. В этом случае удобнее проводить удаление пера против его роста.
  5. Дальнейшее опаливание поможет избавиться от оставшихся колодок и пуха.
  6. Копоть удаляется промыванием.

Горячий способ с помощью мешка и утюга

Этот метод ощипывания также заслуживает внимания, хотя и применяется реже предыдущих.

При ошпаривании утюгом кожа на тушке утки не рвется, перо сходит легко.

Он осуществляется с помощью утюга, кипящей воды и мешковины из натуральных волокон в следующей последовательности:

  1. В кипящей воде замочить холщовый мешок и с предосторожностями отжать его.
  2. Поместить в мешок утку, плотно ее обернув и оставив лежать на 10-15 минут.
  3. Максимально нагретым утюгом несколько раз равномерно прогладить сверток.
  4. Развернуть мешковину и приступить к обработке тушки в той же последовательности.

[adsp-pro-6]

Способ удобен тем, что прогретое перо легко снимается, а риск повреждения кожи минимален. Поэтому применяется охотниками, для подстреленной дичи с пробитой шкуркой. В отличие от ошпаривания мясо сохраняет свой цвет.

Важно. Методы горячей обработки хоть и несложны, но травмоопасны. Вынимать тушку из воды лучше щипцами. Начиная процесс ощипывания, следует соблюдать осторожность, т.к. мокрое перо долго остается горячим. Стоит быть повнимательнее и с горячим утюгом.

Конечно, перечисленные методы освобождения утиных тушек от пера годятся только при наличии небольшого количества птицы. Хозяева же крупных птицеводческих ферм знают, как быстро справиться с этой задачей при помощи перосъемной машины. Впрочем, небольшие перосъемные насадки для шуруповерта могут облегчить процедуру и вполне по карману даже владельцу нескольких птичек на дворе.

Самый быстрый способ ощипывания утиной тушки — использование перосъемной машины.

Сохраняем утиные перья и пух

Помимо мясной продукции утки способны давать замечательный материал в виде пуха и пера. Утиный пух менее ценен, чем гагачий, лебяжий или гусиный. Однако он тоже обладает отличными теплоизоляционными свойствами. Пух и мелкие перышки послужат хорошим наполнителем для одеял и подушек, а остальное перо пригодится на кухне для смазывания выпечки, различных поделок и декорирования.

Как упоминалось выше, пригодный для дальнейшего использования материал можно получить при сухом способе ощипывания.

Правильная подготовка сырья позволит использовать его до десяти и более лет:

  1. Сортировка. Удобнее проводить во время процесса щипки, сразу разделяя мелкое перо с пухом от крупного.
  2. Стирка. Чтобы избавиться от жира, запаха и грязи, собранная масса замачивается в теплом растворе мыльной воды на 2-3 часа. Затем нужно тщательно прополоскать сырье в большом количестве прохладной воды и отжать.
  3. Сушка. Чистый пух сушится в тканевом мешке в проветриваемом сухом помещении или на солнце. Чтобы избежать загнивания перо подвергается периодическому встряхиванию и ворошению.
Многие птицеводы сохраняют пух и перо утки при ощипе.

Правила разделывания утки

После ощипывания, опаливания и промывания утки желательно сразу же приступить к ее потрошению. Сначала отрезают шею. В первую очередь следует удалить кишечник, чтобы предотвратить порчу продукта, особенно в теплое время года. Для этого нужно осторожно проделать отверстие у клоаки и через него вытянуть кишки, одновременно вырезав сальную железу.

[adsp-pro-7]

Пищевод и зоб вынимается через отверстие на шее. Затем разрезают брюшко, чтобы выпотрошить легкие, сердце, печень и желудок. Эти субпродукты откладываются отдельно для приготовления из них различных блюд. Отделяется и откладывается жир, который впоследствии можно будет перетопить и использовать для жарки. Крылышки отрезаются по первый сустав, ноги – чуть ниже пяточного сустава. Также можно удалить и шею, не представляющую большой пищевой ценности.

Выпотрошенная тушка тщательно промывается от остатков крови с неоднократной сменой воды. После стекания воды и обсыхания тушки готовы к заморозке.
Если предполагается приготовление утки частями, то следующим этапом будет разделка тушки.

После ощипывания тушку утки необходимо выпотрошить и разделать.

Нащупав суставы, делают по ним надрезы и отделяют сначала окорока, затем крылья. Уложив утиную тушку на спину, делают вдоль киля разрез и отделяют филейную часть. Оставшийся костный остов из ребер и позвоночника разделяют и в дальнейшем используют для приготовления бульонов. Кожу отправляют к жировой массе для перетопки.

Теперь можно приступать к конечной цели – приготовлению утиного мяса.

После ознакомления с тем, как можно вручную ощипать и разделать утку, надеемся, что у вас все получится быстро, качественно и без лишних хлопот.

На видео фермер показывает весь процесс ощипывания и разделки утиной тушки.

Как правильно разделать утку на порционные куски

Утка – отличная мясная основа для создания многочисленных блюд: супа, холодца, плова и т.д. Ее можно запечь целиком, когда в доме намечается праздник и будет множество гостей. Но если в наличии имеется целая тушка, а едоков только двое, то невольно задумываешься о том, что ее лучше бы разделать и заморозить кусками в морозилке, оставив на обед или ужин пару кусочков.

Это неплохая идея, тем более отдельные части утки предназначены для разных рецептов. К примеру, гузка или хвост и очищенный от мяса остов пригодятся для создания наваристого и ароматного бульона. Из утиных ножек можно приготовить вкуснейшее конфи, которое будет таять во рту. Крылья рекомендуется использовать для супа, а утиную грудку (деликатес) лучше всего обжарить и запечь в духовке, после чего подать с ягодным соусом.

Как видите, из одной тушки получится не менее 4-5 вкуснейших блюд, поэтому, не медля, принимайтесь за ее разделку, ведь в этом нет ничего сложного!

  1. Перед разделкой обязательно удалите из гузки копчиковые железы (мускусные), так как их запах может испортить бульон. Тушку промойте в воде, обсушите бумажными полотенцами, выложите на удобную досочку или блюдо, которое не скользит по рабочей поверхности.
  2. Сначала отрезаются окорочка. Поверните тушку отверстием к себе и оттяните ее ножку. По коже, которая натянулась, сделайте надрез острым ножом и дорежьте до низа с одной и другой стороны.
  3. Затем разломите косточки между тушкой и ножкой и полностью срежьте окорочок. Такие же манипуляции проделайте и с другим окорочком. Отложите эти части в отдельную емкость.
  4. Срежьте оставшуюся после ножек кожу с кусочками утиного жира, вместе с гузкой – эти части пойдут в бульон или в горячее.
  5. Теперь займитесь крыльями – выверните каждое из них как ножку и натяните кожу. По ней пройдитесь острым ножом, стараясь захватить как можно меньше мяса на грудке, иначе отрежете большую часть утиного филе. Кости крыла даже не придется разламывать – их можно просто подрезать.
  6. Если на крыльях присутствует и остаточная верхняя фаланга, то отрежьте ее и удалите – в ней нет ни мяса, ни жира.
  7. Затем поверните утиную тушку отверстием от себя и начните срезать филе по ребрам, зачищая их ножом. Помните, что посередине грудки есть килевая кость. Счистите одну часть утиной грудки до нее и срежьте.
  8. Точно так же поступите и с другой частью грудины. Не удаляйте кожицу с филе – его жарят кожей вниз, иначе оно получится суховатым на вкус!
  9. После этих действий у вас должен остаться очищенный остов птицы с нижней частью спины.
  10. Именно ее и отломите от остова, подрежьте ножом. Эту часть можно добавлять при варке супа или бульона. Последним разрежьте остов пополам по ребрам, слегка подламывая их.
  11. Вот и все, вы с легкостью разделали утку и у вас в наличии оказались: два окорочка, два крыла, два филе, две части остова, нижняя часть тушки и обрезки с жиром для бульона (включая и гузку).
  12. Разложите мясо по пакетам или контейнерам. Подпишите, что именно отправили в них и дату заморозки. После этого заморозьте, оставляя необходимый для приготовления кусочек свежим.

Утиным мясом для создания будущих блюд вы обеспечены. Вам останется лишь найти подходящие рецепты. Тогда вы сможете накормить свою семью вкусными блюдами. Кстати, рецепты из утки вы найдете на нашем сайте – просто вбейте в поиск первые три буквы слова «Утка»!

Как ощипать и разделать дикую и домашнюю утку в домашних условиях

Ощипывать утку дома должен уметь не только деревенский житель, но и городской, ведь это очень полезное умение, которое может пригодиться и дома, при покупке живой утки, и при разделывании дикой птицы на природе. Бояться этой процедуры не стоит, она очень простая, и благодаря этой статье вы разберётесь, как ощипать утку.

Сразу стоит отметить, что при упущении некоторых факторов можно изменить вкус будущего мяса.

Когда и как правильно убирать птицу

Для начала необходимо определиться, когда же следует забивать птицу. Самое подходящее время для убоя это около 2 месяцев роста птицы. Именно в это время уже полностью отрастёт пух и удалять его будет гораздо удобнее. Но на крыльях пух не должен быть полностью созревшим, так как-то время, когда необходимо убирать птицу будет упущено, а при её забое на коже может быть мелкий пух, который повредит товарный вид утки. Если такая ситуация произошла, тогда необходимо отложить процедуру на две недели, чтобы мелкие ости отрасли и их было удобно удалять с поверхности кожи.

Перед забоем птицу следует подготовить:

  1. Очистить желудок и зоб от пищи. Для этого за 12 часов птицу не нужно кормить, но её можно поить без ограничений.
  2. перед забоем у птицы всю ночь, должно быть, освещение.

Домашнюю утку, как и любую другую птицу, забивают по одному типу. Конечно, если это происходит в деревне, тогда все становиться гораздо проще. Для того чтобы обезглавить птицу нужно:

    • тщательно наточить топор;
    • найти укромное место и взять в руку оба крыла птицы;
    • сложить голову птицы с небольшим наклоном на небольшую и ровную возвышенность и опустить с размахом топор на шею птицы;
    • для того чтобы с тушки полностью стекла кровь её нужно подвесить на проволоку и оставить на некоторое время.

А также можно воспользоваться и другим приспособлением для убоя птицы, как цилиндр. Для процедуры необходимо:

  • опустить утку в него и вытянув голову отрезать её острым ножом;
  • оставить стекать кровь на 15 минут.

Способы ощипывания

Хочется сказать, что найдётся очень мало хозяек, которым это нравится, так как на коже птицы остаётся очень много перьев. А если выбрать правильный способ, тогда можно справиться даже с самым тяжёлым случаем очень легко и быстро. Имеются сухой и горячий способы ощипывания.

Сухой способ

Один из первых и самых распространённых быстрых способов очистить тушку утки – это сухое ощипывание. Применять его следует сразу после того, как утка была забита.

Итак, расположитесь удобнее. Птица должна лежать так, чтобы голова была внизу и кровь свободно стекала, обычно это на коленях. Рядом должен стоять таз или ведро – туда будут складываться ощипанные перья.

Начинать ощипывать необходимо с грудки, после этого перейти на спину и плечи, закончить следует хвостом и крыльями. После того как тушка готова на ней можно заметить небольшой волосяной покров, от которого вручную избавиться невозможно. Для этого подойдёт кухонный нож. Его нужно прижать к тушке и взять волоски в руку и резким движением их выдернуть.

После этого в тушку необходимо втереть немного муки, чтобы избавиться от влаги.

Если нет времени на долгое избавление от пуха и мелких остей тушку можно просто опалить. Сделать это можно над газовой плитой или же над обычной лампой. Обязательно нужно следить за процедурой, ведь одно неловкое движение и тушка может загореться. Для этого нужно:

  • все части расправить ровно и развернуть крылья;
  • в этом виде её поднести к плите и аккуратно опалить, но нужно следить, чтобы с тушки не выплавился жир, иначе она потеряет свой привлекательный вид;
  • в это время тушка может покрыться копотью, но это ничего страшного, так как все лишнее впоследствии смоется;
  • после процедуры тушку промыть.

Горячий способ

Следующим способом ощипывания домашней утки является ошпаривание, но и здесь нужно соблюсти все условия. После того как у птицы кровь стекла нужно сделать следующие действия:

  1. Вскипятить воду и дать ей немного постоять, если применять кипяток кожа с тушки может слезть и тогда ощипать тушку не получится.
  2. После этого птицу нужно опустить в кастрюлю и подержать несколько минут.
  3. После этого можно начать ощипывать. Делать это можно так, как вам удобно или же в другую сторону от хвоста.
  4. После того как дело сделано, тушку нужно опалить.

Этот способ подходит для тех, кому не подходит быстрый способ, и нет времени после забоя, но после кипятка мясо тушки покраснеет.

Одним из горячих способов ощипывания является процедура с помощью мешка.

Этот способ очень распространён. Для этого способа понадобится мешок, а также таз и утюг. Для того чтобы ощипать утку этим способом потребуется:

  1. взять мешок и окунуть его в кипящую воду минут на 20;
  2. После этого мешок нужно хорошо отжать и туда опустить тушку, после чего погрузить его в воду с горячей водой минут на 5.
  3. после этого вытащить мешок из воды, а перед этим нагреть утюг и прогладить утку через мешок;
  4. после этого можно достать тушку и продолжить процедуру ощипывания.

Как разделывать утку

Для того чтобы самостоятельно приготовить тушку утки необходимо знать не только как ощипать тушку, но и как её разделывать. Для того чтобы разделать быстро домашнюю утку необходимо соблюсти некоторые факторы:

  1. Для начала нужно отрезать шею, а вот кожу нужно оставить, для того чтобы ей прикрыть то место, где была отрезана шея. Обычно это делается для фаршированной утки.
  2. Ноги необходимо отрезать на сгибе около пяток.
  3. Крылья убрать на ту длину, которая вам нужна.
  4. После этого необходимо вскрыть живот и убрать все внутренности и полностью очистить тушку внутри.
  5. Затем утку нужно хорошо промыть в воде, но увлекаться тоже не стоит, чтобы она не потеряла вкус, после этого её можно заморозить или использовать по требованию.

На вопрос как ощипать дикую утку стоит сказать, что ощипывание домашней утки ничем не отличается от ощипывания дикой утки.

У каждого птицевода собственные методы ощипывания птиц, но стоит отметить, что обязательным условием ощипывания это проводить процедуру по направлению роста, а само ощипывание проводить только спустя несколько часов после забоя именно в это время жир под кожей застынет и сохранит полезные свойства.

Все вышеперечисленные советы помогут быстро ощипать утку в домашних условиях, а при необходимости дикую утку на природе.

Как ощипать утку правильно - Smak.ua

Однако подготовка утиной тушки в домашних условиях занимает изрядное количество времени. Поэтому имеет смысл заранее узнать, как разделать утку быстро и без лишних хлопот. 

Читай также: Как правильно разделать целую курицу

Основные способы подготовки утки в домашних условиях

Если с приготовлением утки особых сложностей нет, то по части ощипывания они зачастую возникают. В магазинах или на базаре тушки продаются уже ощипанными и потрошеными. Хозяйке остаётся лишь разделать и приготовить ее. Иначе обстоят дела с уткой домашнего производства, ее нужно избавить от перьев и выпотрошить. Как это сделать? Существует несколько способов. 

Сухой способ

В этом случае утку ощипывают практически сразу после забоя, этот процесс совмещается с опаливанием.
 
1. Садятся на табуретку и занимают удобную позу. 

2. В доступности протянутой руки ставят ёмкость для пуха и перьев — например, широкий таз или ведро. 

3. Птицу размещают на коленях так, чтобы её голова свисала вниз с колен. 

4. Аккуратно снимают перья и пух, стараясь не повредить кожицу тушки. Действовать нужно выщипывающими движениями. 

5. Остатки небольших волосков убирают с помощью ножа — прижимают его к пальцу, а между ними волос, и с силой выдёргивают. 

6. С помощью горелки аккуратно опаливают тушку (расправляют её без складок, стараются не приближать огонь слишком близко, чтобы не растопился подкожный жир). 

Важный момент касается технологии выдёргивания: перья нужно вырывать резко и обязательно против роста в следующей последовательности: 

• сначала на груди; 
• затем перейти на спинку, шею и плечи; 
• далее избавиться от маховых перьев на крыльях; 
• хвостовая часть — заключительная. 

Из плюсов этого метода следует отметить его бескровность. Минусом являются большие затраты времени. Процедура длительная, требует усидчивости. Иначе на коже останутся многочисленные обломки перьевых стволов. Они будут помехой при дальнейшей готовке птицы. Тем не менее, способ позволяет обработать тушку дочиста. 

Читай также: Утка с хрустящей корочкой

Горячий способ

Этот метод применяют для обработки утки свежего забоя, или тушки уже успевшей остыть. В основе способа лежит ошпаривание кипятком. 

1. Тушку помещают в просторную кастрюлю или глубокий таз. 

2. Отдельно нагревают воду, не доводя её до кипения. 

3. Тщательно проливают каждый участок тела тушки из чайника или объёмного ковша — держат за концы лап, аккуратно переворачивают. Лить нужно быстро и обильно, чтобы вода не успевала остыть и захватывала поливаемый участок полностью. 

4. Затем заполняют таз горячей водой до краёв и оставляют тушку на четверть часа. 

5. Птицу извлекают, дают воде стечь, тушку ощипывают. 

6. Заключительная процедура — опаливание небольшой горелкой или зажжённой свечой. 

У такого метода самый важный плюс — быстрое избавление от пера. И довольно качественное. Но есть и минус: трудно угадать с температурой воды. Слишком горячая вода приведёт к изменению цвета мяса. Пользуйтесь термометром для определения градуса нагрева, оптимальная температура примерно 80–82°C.

Читай также: Гости будут в восторге: барбекю «Деликатная уточка»


 

Если вы заметили ошибку, выделите необходимый текст и нажмите Ctrl+Enter, чтобы сообщить об этом редакции.

как правильно забить птицу и ощипать тушку? Метод сухого ощипывания

Забить утку несложно, но как ощипать утку правильно, многие не знают или у них мало опыта. Есть рекомендации, следуя которым каждый может научиться делать это быстро. Конечно, у каждого, кому приходилось этим заниматься, есть свои методы, но если не учитывать некоторых нюансов, это может испортить вкус мяса и повлиять на сроки его хранения.

Забой домашней птицы

Время, когда утка больше всего подходит для забоя, можно определить по тому, в каком состоянии находится ее оперение. Самый удобный момент через 60-65 дней, так как к этому времени в первый раз полностью отрастает перьевое покрытие, при этом перья на крыльях еще не должны быть зрелыми, иначе, можно считать, что подходящий момент для убоя упущен, тушка утки будет щетинистой и потеряет свой привлекательный вид. Отложите забой дней на десять, чтобы отрасли маленькие перья, тогда выщипать их будет намного проще.

Перед тем как забить утку в домашних условиях, ее предварительно к этому подготавливают. Чтобы очистить желудок и зоб у птицы от остатков пищи рекомендуется за 12-16 часов до забоя уток не кормить, хотя воду можно давать без ограничения. Обязательно, чтобы в помещении, где содержится выбранная птица, в ночь перед убоем было освещение.


Для забоя утки, как и любой другой домашней птицы, лучше применять проверенный и надежный наружный способ. В частном доме это сделать проще и удобнее. Всегда можно найти укромное место во дворе, чтобы обескровить тушку.

  1. Птицу подвесьте за ноги, с заложенными друг за друга крыльями, или используйте конусы, как на фото выше;
  2. Взяв за голову, вытяните шею и перережьте ножом сонную артерию. Во время забоя нож держите направленным не перпендикулярно шее, а немного с наклоном вниз;
  3. Чтобы тушка полностью обескровилась, ее потребуется подержать в подвешенном состоянии 5-10 минут.

Когда кровь перестанет вытекать, приступаем к следующему этапу – ощипыванию.

Методы ощипывания

Не каждой хозяйке может принести удовольствие процесс ощипывания, но при соблюдении точного алгоритма и выборе наиболее удобного способа, от перьев можно избавиться легко и быстро. Есть несколько проверенных на практике методов ощипывания утки. Так, можно выделить сухой и горячий (ошпаривание) методы.

Сухой способ обработки

Рассмотрим, как можно быстро обработать и почистить от перьев тушку утки. Самый распространенный метод - сухой. Его принято применять непосредственно после того, как утка была забита.


  1. Присядьте на что-то таким образом, чтобы была возможность держать забитую птицу на коленях. Голова утки должна свисать. Внизу поставьте приготовленную заранее посуду, куда будут складываться выщипанные перья;

    Чтобы не повредить кожицу, перья утки старайтесь удалять аккуратно. Если при ощипывании повредить кожицу, она начнет расползаться и продолжать выщипывать будет трудно и неудобно.

  2. Выщипывать перья начините с груди, затем удалите на спине и плечах. Последними очищаются от перьев крылья и хвост;
  3. Чтобы полностью ощипать уток в домашних условиях этого недостаточно. После удаления крупных перьев на тушке остаются маленькие волоски. Одними руками ощипать их невозможно. Сделать это лучше с помощью ножа:
    • Тупой стороной приложите его к тушке;
    • Большим пальцем прижмите волоски к ножу и резким движением на себя выдерните их.
  4. Далее тушку обваляйте в муке, втирая ее круговыми движениями. Так лучше впитается излишек влаги;
  5. Чтобы не тратить напрасно много времени на выщипывание пуха и маленьких волосков, опалите тушку. Делайте это аккуратно, все время наблюдая за тем, чтобы утка не загорелась.
    • Расправьте тушку так, чтобы на коже не осталось складок, крылья разверните в стороны;
    • В таком виде поднесите ее к горелке и опалите. Делайте это осторожно, иначе жир под кожей расплавится, кожица повредится и утка потеряет свой товарный вид;
    • Во время этой процедуры обычно появляется копоть, которой не нужно бояться, так как она смоется вместе с мукой. Опаливайте утку не торопясь.
  6. Промойте тушку.

В этой же последовательности ощипывают и дикую утку.

Горячий способ обработки или ошпаривание

Рассмотрим, как быстро ощипать утку, применяя метод ошпаривания, и сделать это правильно. Для использования этого метода между убоем и ощипыванием должно пройти не меньше чем четыре часа.


  1. Согрейте воду в кастрюле до восьмидесяти градусов. Кипящая вода не подходит, так как ошпаривание кипятком может привести к тому, что кожа на тушке лопнет и удалить перья будет непросто;
  2. Окуните утку в кастрюлю, оставив на минуту;
  3. Начните ощипывать. Будет быстрее и удобнее, если перья вырывать в противоположную сторону от их роста;
  4. Вначале выдерните перья из крыльев, а потом из хвоста. Затем приступите к удалению пуха с шеи и груди. Со спины и ног пух выщипывается в последнюю очередь;
  5. Когда все перья будут удалены, тушку опалите.

В этом методе очистки утки от перьев есть один минус: после ошпаривания мясо утки краснеет. Но есть и плюс, именно такой способ удобен тогда, когда нет возможности ощипать птицу сразу после забоя.

Тонкости и нюансы быстрого ощипывания

Для того чтобы выбрать какой-то способ ощипывания, можно попробовать все и остановиться на том, который покажется наиболее подходящим и удобным. Используя горячий метод ощипывания, не забывайте о том, что цвет мяса может измениться. Нагрев, как и любая термическая обработка, оказывает влияние на мясо и после горячего способа ощипывания птицу лучше не хранить, а приготовить сразу. Если тушка некоторое время будет храниться в холодильнике, в этом случае подойдет сухой способ удаления перьев.

Чтобы не обжечь руки и не повредить на утке кожу, после применения горячего способа не нужно сразу же начинать выщипывать перья. Дайте тушке немного остыть.

В процессе опаливания обжигают только мелкие волоски и пух.

Правила разделывания утки

Рассмотрим как правильно разделать утку. Для разделки дикой утки, как и для домашней, применяется одинаковая последовательность действий:

  1. Отрежьте шею. При этом надрежьте кожу, оставив часть спереди, чтобы ей можно было закрыть место отреза, если утка будет готовиться фаршированной;
  2. Найдите, где на ногах находится пяточный сустав, и отрежьте ноги на два сантиметра выше;
  3. Крылья удалите по первый сустав;
  4. Разрежьте брюхо и удалите потроха. К потрохам относятся сердце, желудок, печень и легкие. Брюшной жир тоже нужно удалить. Пищевод и зоб вытащите через отверстие в шее и отрежьте;
  5. После удаления потрохов тушку промойте под холодной проточной водой и самым тщательным образом. Долго заниматься промывкой не стоит. Чем дольше ее держать в воде, тем больше она потеряет питательные веществ;
  6. После промывки тушку разложите на противень, и дайте обсохнуть. Если ее не предполагается готовить сразу, тушку можно заморозить;
  7. Для того чтобы приготовить какое-либо блюдо разделку тушки утки необходимо продолжить;
  8. Иногда после приготовления в блюде из утки могут оказаться мелкие кости. Чтобы этого избежать, сохраните целыми трубчатые кости, не нужно пытаться перерезать или перерубить их. Делать надрезы лучше в местах суставов:
    • Вначале разделочным ножом отсоедините окорока, при этом мясо захватите ближе к спине;
    • Чтобы удалить крылья, надрезы сделайте около позвонка;
    • Для отделения филейных частей, утку положите на спину, а вдоль киля сделайте надрез и постепенно срезайте мясо;
    • Кухонными ножницами удалите ребра;
    • Перед тем, как отрезать хвост, удалите сальную железу, которая может при приготовлении мяса испортить его вкус.

После отделения всех частей, от тушки останется позвоночник и жирная кожа. Закончив разделку, кожу и жир можно перетопить, а из позвоночника приготовить бульон. При правильной разделке с пользой можно использовать не только мясные части, но и все остальные.

Мясо утки является одним из самых полезных, поскольку содержит большое количество белка, витаминов и минералов, аминокислот. Однако процент жира в птице намного больше, чем в другом мясе, поэтому она не подходит для диетического питания. Жир, конечно, полезен, поскольку способствует очищению организма человека от канцерогенов. Он также включает ферменты, которые регулируют обменные процессы.

Поскольку домашние утки очень жирные, часть жира рекомендуется срезать заранее. При приготовлении блюд остальная часть вытопится, пропитает гарнир, придавая ему специфического вкуса. Но перед тем как готовить, необходимо узнать, как ощипать утку и правильно её разделать.

Методы ощипывания

В супермаркетах обычно продают птицу уже ощипанную, готовую для разделки. Но многим приходится удалять перья самостоятельно, особенно это актуально в тех семьях, где есть охотник. Конечно, всем хозяйкам приносит удовольствие этот процесс, но если соблюдать точный алгоритм и подобрать наиболее удобный способ, то можно избавиться от перьев быстро и легко. Сегодня известно несколько методов того, как ощипать утку. Так, выделяют сухой способ (опаливание) и горячий (ошпаривание). Познакомимся с каждым из них более детально.

Сухой способ или опаливание

Этот метод применяется сразу после того, как утка домашняя была убита. Прежде всего, необходимо сесть на стул таким образом, чтобы тушка свисала вниз головой с колен. Рядом ставится тара для перьев и пуха, которые аккуратно снимаются, чтобы не повредить кожицу. Рекомендуется сначала снимать маховые перья против роста резкими движениями, а потом аналогичным образом и хвостовые.

Если применяется бескровный способ ощипывания, то сперва выдёргивают перья на груди, переходят на спину, потом шею, плечи и, наконец, на крылья. Тушку очищают дочиста.

Итак, рассматриваем, как правильно ощипать утку дальше. Когда на птице остались небольшие волоски, их убирают тупой стороной ножа, а потом её натирают мукой. Для этого просто утку обваливают в муке, а потом её втирают в тушку массирующими движениями для того, чтобы лишняя влага впиталась.

Опаливание тушки

Опаливать тушку необходимо очень осторожно, чтобы не повредить кожу, а подкожный жир не расплавился. Прежде чем приступать к самому процессу, необходимо утку расправить так, чтобы не было на коже складок. Для этого её растягивают, крылья разворачивают и так подносят к горелке. Теперь можно и опаливать.

Не нужно бояться копоти, поскольку она вместе с мукой хорошо смывается под проточной водой. Утка домашняя должна опаливаться не торопясь. После всего проделанного тушку промывают.

Горячий способ или ошпаривание

Для этого метода понадобится некоторый инвентарь: кастрюля, в которую помещается тушка, и чайник с достаточным количеством кипятка. Рассмотрим, как ощипать утку этим способом. Итак, прежде всего тушку кладут в кастрюлю. Воду в чайнике подогревают до восьмидесяти градусов. Птицу поливают водой, стараясь, чтобы она попадала на перья. Этот процесс проделывают с обеих сторон. Затем утку заливают полностью водой и оставляют на пятнадцать минут. Далее начинают её ощипывать, при этом перья вырывают против их роста. Когда тушка будет полностью ощипана, её можно опаливать. Интересно будет узнать, что при использовании горячего способа мясо птицы может поменять свой цвет.

Рассмотрим несколько видов горячего ощипывания.

Метод № 1

Для произведения процедуры понадобится тканевый мешок, металлическая ёмкость, паровой утюг, острый нож. Итак, сначала кладут мешок в ёмкость, например, тазик, потом заливают его кипятком и оставляют на пять минут. По прошествии времени воду сливают, а мешочек отжимают, после чего в него кладут тушку и держат её там пятнадцать минут. Затем начинают вырывать перья. А как быстро ощипать утку и как это правильно делать, мы уже знаем.

Метод № 2

Способ предполагает практически такие же действия, как и в первом случае. Так, мешочек кладут в кипяток на пятнадцать минут, после чего его отжимают и помещают туда тушку. Перед тем как ощипать утку, необходимо мешок с птицей прогладить утюгом и обдать горячим паром. Делать это необходимо около десяти минут, только после этого тушку вынимают и начинают вырывать перья, а потом и пух. Делать это начинают с грудинки, потом переходят на спинку, шейку и крылья.

Нужно отметить, что этот способ имеет один минус - мясо птицы краснеет. Более того, его применяют только тогда, когда прошло четыре часа после убоя птицы.

Как быстро ощипать утку: нюансы и тонкости

Способ ощипывания домашней птицы каждая хозяйка выбирает сама. Со временем, попробовав их все, она остановит свой выбор на самом оптимальном для неё. Не стоит забывать о том, что горячие методы способствуют изменению цвета мяса. Более того, после использования горячего способа удаления перьев птицу необходимо сразу приготовить, поскольку нагрев влияет на мясо, поэтому оно долго не хранится. Если применяется сухое удаление перьев, то тушку можно хранить долгое время в морозилке.

Перед тем как ощипать дикую утку, необходимо запомнить тот факт, что нельзя при методе ошпаривания или проглаживания утюгом удалять перья, когда тушка сильно горячая, поскольку можно обжечь руки, повредить кожу. Нужно также быть аккуратным с утюгом, поскольку утка неплоская, и его носик может задевать пальцы.

Учитывая все нюансы того, как ощипать утку, необходимо обратить внимание на процесс опаливания. Здесь нужно следить, чтобы тушка не загорелась, поэтому все большие перья перед обработкой на горелке удаляют вручную. При опаливании птицу можно держать металлическими щипцами, чтобы обезопасить себя от появления ожогов. Ощипывать рекомендуется быстро, но аккуратно.

Опытные птицеводы рекомендуют проверять время линьки, чтобы при ощипывании не попасть на него, так как в этот период утки щиплются намного труднее, можно сказать, просто ужасно. Время линьки определить несложно. Для этого из живой птицы выщипывают несколько перьев, если это легко сделать, то можно производить забой уток в домашних условиях и приступать к ощипыванию. Если птица перелиняла, то перо срезается вместе с кожей.

Перья при ощипывании можно сразу сортировать на несколько сортов. Сначала они выдёргиваются на крыльях и хвосте, а затем переходят на всё остальное. При этом уток ощипывают дочиста, исключение составляют твёрдые перья крыльев, головы и шеи. Перья выдёргивать необходимо быстрыми рывками «по шерсти», то есть рывок должен идти к хвосту. Их не нужно брать помногу, так как возникает риск повреждения кожи тушки.

Для хранения тушек в холодильнике допускается только сухой метод удаления перьев, а перед опаливанием их необходимо расправить. Для этого крылья разворачивают, держа одной рукой птицу за голову, а второй - за ноги, и растягивают.

Итак, птица ощипана и опалена, что же с ней делать дальше, как разделать утку? Рассмотрим подробнее этот вопрос.

Удаление кишечника птицы

Этот процесс способствует облегчению охлаждения тушки и всегда используется в жаркое время года, чтобы предотвратить её порчу. Так, все кишки, начиная с зоба и заканчивая прямой кишкой, вытаскиваются через отверстие, которое специально делается рядом с задним проходом. Удалять кишечник необходимо в обязательном порядке, если предполагается хранение птицы в холодном месте.

Как правильно разделать утку

Перед тем как потрошить птицу, ей отрезают шею. Перед этим на ней разрезают кожу, оставляя только часть со стороны грудины для того, чтобы иметь возможность закрыть зобную часть и место отреза перед заправкой тушки. Затем отрезают крылья и ноги. Ноги при этом отрубают на два сантиметра ниже пяточного сустава, а крылья - по первый сустав.

Потом разрезают брюхо и потрошат утку, удаляя желудок, сердце, печень, лёгкие (их можно отложить и позже добавлять в качестве ингредиентов при приготовлении блюд). Не стоит забывать о брюшном жире, который также необходимо удалять. Зоб и пищевод вынимают через отверстие на шее. При помощи кухонных ножниц можно отрезать концы крыльев и шею, так как они не представляют никакой ценности, поскольку на них нет мяса.

Выпотрошенные и разделанные тушки промывают в холодной воде очень тщательно, периодически меняя её несколько раз. Необходимо помнить о том, что в воде птица должна пребывать недолго, в противном случае она потеряет все свои питательные и экстрактивные вещества, поэтому после промывки её нужно сразу вытягивать. После всего этого тушки складывают на противень и дают им обсохнуть. Далее их можно замораживать. Но если они предназначены для приготовления каких-либо блюд, их разделывают дальше.

Второй этап разделывания уток

Итак, рассмотрим, как разделать утку дальше. Здесь важно сохранить целостность трубчатых костей, чтобы сберечь красивый вид кусков и предупредить попадание в блюдо мелких осколков. Для этого пальцами нащупывают суставы и делают в тех местах надрезы. Сначала отсоединяют окорока с помощью разделочного ножа, захватывая мясо ближе к спине. Таким же образом отделяют крылья, делая надрезы ближе к позвонку. Переходим к филейной части. Утку кладут на спину и делают разрез вдоль киля. Филе можно разделить на несколько частей. Рёбра и хвост отделяют от хребта при помощи ножниц. Сальную железу удаляют заранее, чтобы не испортить вкус мяса при его приготовлении.

Таким образом, отделив все части, у нас должен остаться позвоночник с жирной кожей. Кожу отделяют и отправляют на перетопку вместе с жиром, позвоночник откладывают для приготовления бульона.

Теперь, когда мы познакомились с процессом ощипывания и с тем, как разделать утку, рассмотрим, какую пищевую ценность представляет собой эта домашняя птица.

Полезные свойства домашней утки

В состав мяса этой домашней птицы входит большое количество натрия, железа, меди и калия. Мясо очень питательное и сбалансированное. Есть также в нём и витамины. Большую пользу человеческому организму приносит утиный жир. Он способствует его очищению от канцерогенных веществ. Есть в нём и ферменты, способствующие регуляции обменных процессов. Однако не следует употреблять мясо утки в больших количествах тем людям, кто страдает заболеваниями желудка, поджелудочной железы и печени. Во всём остальном утка не наносит никакого вреда организму человека, её можно смело употреблять в пищу в больших количествах.

На основе этого продукта готовят множество первых блюд: супы, рассольники, солянки, борщи, щи и прочее. Но из-за большой жирности и калорийности утку рекомендуют готовить с овощами, фруктами. Хорошо подходят в этом случае кислые яблоки или капуста квашеная. Крупную жирную птицу фаршируют крупами, фруктами, ягодами или овощами, грибами или орехами. При этом эти все продукты можно использовать в различных сочетаниях, например, капусту кладут с яблоками, а макароны с черносливом. Во всяком случае фантазии есть где разгуляться!

Теперь, когда мы познакомились с тем, как быстро ощипать утку и её разделать, можно приступать к делу. Сложного в этом ничего нет, хотя процесс сам по себе довольно долгий и хлопотный. Но этому можно быстро научиться.

Перед владельцами фермерских хозяйств часто возникает проблема: как ощипать утку в домашних условиях? После забоя птицы далеко не все заводчики успешно справляются с разделкой пернатых. Предлагаем узнать о наиболее легких и простых способах, которые позволят без особого труда ощипать утку самостоятельно.

Чаще всего заводчики, чтобы избавиться от перьев, используют горячий способ

Как ощипать утку в домашних условиях, видео

Чтобы представить себе как проходит эта процедура, можно посмотреть видео. Однако есть несколько аспектов, о которых нужно знать начинающему фермеру. После убоя утку желательно оставить на пару часов. Перья не торопитесь выбрасывать, ведь пух птицы очень ценен. Его часто используют в качестве наполнителя подушек. Изначально избавляются от крупных перьев, которые расположены на крыльях и хвосте. Делать это стоит бережно, чтобы не повредить кожу птицы, в противном случае ее товарный вид испортится, что неблагоприятно скажется на скорости реализации продукта на рынке.

Ознакомьтесь с одним из самых легких методов ощипывания утки, наиболее часто применяемым в домашних условиях. Для этих целей нужно подготовить горячую воду, утюг и мешок. Заводчику нужно выполнить следующие действия:

  1. Выбрать мешок из плотного и добротного полотна, предварительно замочив его в горячей воде. Далее отжать и положить в него тушку птицы.
  2. Оставить ее в завязанном мешке примерно на 15 минут.
  3. Подготовьте утюг и аккуратно прогладьте перья через мешковину. Важно действовать аккуратно, чтобы избежать термического ожога.
  4. После проглаживания стоит приступить к ощипыванию утки (как правило, перья с легкостью отделяются).

После убоя утку желательно оставить на пару часов

Конечно, не только горячий способ ощипывания является популярным. На фото сможете ознакомиться и с другими подходящими вариантами. Так сухой метод ощипывания считается не менее легким и востребованным.

Как правильно ощипать утку от перьев в домашних условиях?

Заводчики стремятся не только быстро, но и без особых усилий справиться с подобной задачей. Этой процедурой в большинстве случаев занимаются сразу после забоя пернатых, пока утка еще теплая. Выполнять все действия важно очень аккуратно, чтобы не повредить кожный покров утки. Вот основные из них, а именно:

  1. Утку кладут на газету или ненужную простынь, после чего выдергивают самые крупные перья птицы. Делать это желательно по направлению их роста, постепенно переходить к спине.
  2. Шею и грудную клетку должны ощипывать в последнюю очередь, ведь на этих участках самые мелкие перья.
  3. Затем заводчику предстоит избавиться от пуха. Справиться с этой работой можно, используя тупой нож. Однако тушку утки также рекомендуют обвалять в муке, а затем опалить над огнем.
  4. В завершении птицу стоит тщательно промыть водой с целью удаления копоти и сажи.

Фермеры придумали множество механических приспособлений, помогающих быстро ощипать утку в домашних условиях

Если нужно ощипать быстро в домашний условиях, то этот способ будет самым подходящим и простым даже для новичка. Если заводчик решает остановиться на горячем способе ощипывания, то стоит помнить, что цвет мяса птицы может измениться. Тушка подвергается термической обработке, поэтому рекомендуют ее сразу приготовить. а не класть в холодильник. В противном случае лучше остановиться на сухом методе удаления перьев с утки.

Видео о том, как ощипать утку без пеньков:

Если вы стремитесь точно узнать о том, как ощипать в домашних условиях правильно и максимально быстро, рекомендуем посмотреть видео, а также прочесть советы из статьи. Опытных владельцев фермерских хозяйств побуждаем делиться отзывами и секретами разделки птицы, ее ощипывания. Если все сделать правильно, то можно не сомневаться в том, что удастся сохранить ценный пух, а также товарный вид тушки.

Каждый гордый владелец частного дома или дачи рано или поздно приходит к мысли – а не завести ли мне немного домашней живности: курочек, уточек, гусей, а лучше всех их понемногу! И вот уже все готово – сарайчик для ночевки, ограждение для выгула, кормушки, и завезен птичий молодняк. Птица растет, набирает вес и приходит время подавать ее, выращенную своими руками, к столу. И тут уже нужно думать, как обработать птицу легче и быстрее. Поможем вам изучить этот вопрос подробнее.

Как правильно ощипать птицу

Заводить и выращивать домашнюю птицу заманчиво: будут яйца, полезное мясо и даже пух и перо для подушек, одеял и одежды. Если яйца птицы несут без постороннего вмешательства, то для получения качественного мяса и чистых перьев нужно научиться правильно ощипывать тушки. Кур и индеек ощипывают после убоя, а утку и гуся – через 2 часа, чтобы сохранить перья и пух.

Очередность удаления перьев, как правило такая: первыми удаляют перья с хвоста и крыльев, далее – с грудки, спинки и в последнюю очередь с лапок. Причем перья и пух удаляют аккуратно, сохраняя целостность кожи. Ощипав птицу, снимают остатки оперения с помощью ножа и опаливают тушку пламенем. Ощипывание может проводиться как вручную, так и с помощью механических приспособлений – например, перочистки для птицы.

Знаете ли вы? Если цель – получить очень мягкую подушку или одеяло, нужно наполнять их гусиным пухом или перьями, освобожденными от твердых колодок.


Перед забоем рекомендовано не кормить птицу несколько часов для естественного очищения желудка от корма, при этом у нее должна быть свежая вода в свободном доступе. Ощипывание удобнее проводить в положении сидя, расположив перед собой тушку и емкости для перьев, пуха и очищенной в итоге птицы. Ручное ощипывание одной тушки занимает примерно полчаса времени. Вручную можно ощипать птицу как сухим ощипыванием, так и с применением ошпаривания.

Ощипывание с помощью предварительного ошпаривания . После забоя птицы дают крови стечь минут 5-7, при этом тушку держат за лапы шеей вниз. Затем курицу или другую птицу полностью окунают в большой бак с горячей водой (температура не менее 90°) на полминуты. Воздействие кипятка откроет поры кожи и облегчит процесс выдергивания перьев.

Ощипывание должно быть бережным, чтобы не повредить кожный покров резким движением. Немного потренировавшись, можно обрабатывать птицу в течение четверти часа, а за день ощипать перья с нескольких тушек. Применение ошпаривания может придать мясу красноты.

Сухое ощипывание . Метод сухого ощипывания не терпит промедления, удаление перьев должно осуществляться по теплой тушке. Выдернув маховые перья хвоста и крыльев, приступают к очистке от перьев спинки, груди и в последнюю очередь крыльев. Маленькое перо выдергивается сильным, но аккуратным движением против роста, можно подхватывать несколько перьев за одно выдергивание. Натянув одной рукой кожицу птицы, можно облегчить и ускорить ощипывание.

Механическое ощипывание с помощью насадки


Летом и осенью существует множество хозяйственных хлопот, нужно все успеть, и возникает закономерный вопрос - как быстро ощипать одну птицу или несколько тушек одновременно? Поскольку инновации добрались и до заводчиков домашней птицы, решить такие вопросы может насадка для ощипывания домашней птицы. Это небольшое приспособление, немного напоминающее ерш, у которого вместо щетины – резиновые выступы – «пальцы» с резьбой.

Рассмотрим,как работает перосъемная насадка. Для начала берется любое вращающее устройство – перфоратор, дрель, шуруповерт или точильное электрическое приспособление. Затем перощипальная насадка крепится на дрель, работающий мотор приводит в движение насадку, она вращается и выдергивает птичьи перья своими резиновыми или силиконовыми «пальцами».

Для работы требуется установить дрель с насадкой на плоскую устойчивую поверхность и подставлять птичью тушку к вращающемуся приспособлению оперением вперед. Такая перосъемная насадка на дрель ускоряет ощипывание тушки до 6 минут, может применяться как в домашнем хозяйстве, так и на охоте для ощипывания дичи. Стоимость насадки примерно 300 гривен.

Важно! Ощипывание птиц сопровождается очень неприятным запахом. Этот процесс лучше осуществлять на открытом воздухе.

Мы рассмотрели общую технологию ощипывания домашних птиц, но удачная обработка каждого вида птиц имеет свои секреты. Изучим особенности скубания кур, гусей и уток.

Как быстро очистить курицу от перьев


При необходимости быстрого освобождения тушки курицы от перьев, нужно ее запаривание в очень горячей воде с добавлением половины чайной ложки пищевой соды в течение полуминуты. Перед этим нужно убедиться, что туша полностью обескровлена. Затем, пока тушка не остыла, снимают кожицу с куриных лап, немного остужают птицу, и можно начинать ощипывание. Очищение курицы от перьев обычно происходит двумя пальцами: большим и указательным.

Выдергивание нескольких перьев происходит по направлению их роста. Глубоко сидящие перья, а также обломанные остатки выдергивают пинцетом. Освобожденную от оперения тушку подсушивают и аккуратно осмаливают на открытом огне костра, газовой печи или баллона, после чего курица готова к потрошению.

Знаете ли вы? Полученное перо и пух следует замочить на несколько часов в теплой воде со стиральным порошком, постирать и высушить. Это обеспечит его долгую сохранность.

Как чистить гусей после убоя


Перед забоем гуся переводят в сухое помещение со слабым освещением, по возможности позволяют искупаться в реке или водоеме для обеспечения чистоты пера. Птице дается вода, корм перестают давать за 10 часов до убоя для очищения внутренностей естественным путем. Зарезав гуся, с него сливают кровь и подвешивают за лапки на несколько часов для охлаждения.

После того как подкожная жировая прослойка застынет, приступают к ощипыванию. Удаляют крупные перья, затем мелкие и в последнюю очередь – пух. Гусей можно очищать любым удобным методом – всухую, с ошпариванием и при помощи специальной насадки для ощипывания птиц, описанной выше.

Некоторые заводчики птиц открыли для себя еще один способ, как скубать гусей. Тушку птицы накачивают воздухом с применением насоса до упругого натяжения кожи и перевязывают шею для удержания воздуха внутри, затем, обернув тушу влажной тканью или марлей, начинают гладить ее утюгом, периодически обдавая птицу потоком влажного пара утюга. Подсохшую ткань разворачивают и начинают ощипывание гуся. При необходимости процесс глажки тушки можно повторить. После удаления перьев тушку осмаливают и разделывают.

С наступлением холодов приходит время забоя домашних птиц в деревнях, в том числе и гусей. Перед хозяевами встает вопрос, как правильно ощипать гуся, чтобы и мясо было вкусное, и пух с перьями можно было использовать в хозяйстве с пользой. Гусиное мясо издавна считается деликатесным, перо и перья гусей являются ценным материалом при изготовлении легких, мягких подушек и перины. Из крупных перьев мастерицы делают очень оригинальные искусственные цветы.

Ощипывание гуся - это очень трудоемкая работа, для этого надо набраться навыков и терпения. Есть один нюанс перед забоем, который надо всегда помнить тем, кто держит эту домашнюю птицу. Опытные хозяева знают, как быстро ощипать гуся, так как забивают птицу перед линькой, точное время которой определяется по-разному.

Когда же нужно забивать гуся на мясо?

Одни гуси на мясо созревают за 310 дней, другим понадобится 270 дней, скороспелые доходят за 8 месяцев.

Начало естественного процесса линьки замечается по тому, что перья с гуся можно легко удалять выдергиванием без упорства и без крови. При этом гуси на выпасе начинают активно терять перо.

Можно пощупать под крылышками туловище птицы. Если во время проведения рукой по туловищу в противоположную сторону роста пера не обнаружится наличие пеньков (пыщиков), значит, готовы к забою. Если пальцы при ощупывании найдут пеньки, то гуся надо оставить до следующей линьки, потому что при ощипывании эти пеньки замучают любого, даже опытного в этом деле человека, и тушка гуся приобретет не товарный вид.

Как ощипать гуся после забоя? Надо знать: гусей ощипывают после забоя тогда, когда с них стечет кровь. Сначала надо приготовить подходящую тару для складывания пуха и пера, для этого сгодятся картонная коробка из-под бытовой техники или высокий ящик. Если надо оставить крупные перья под какие-то нужды, понадобится тара и для них, потому что они тоже могут пригодиться в хозяйстве.

Существует несколько способов ощипывания гусей. Попробуем сейчас разобраться, как правильно ощипать гуся. Среди всех способов самым распространенным издавна является сухой способ удаления перьев и пуха.

Ощипывание домашней птицы сухим способом

Как быстро ощипать гуся сухим способом? Сначала выдергивают крупные перья с хвостовой части тушки, потом с крыльев, с подмышек. Перья с подмышек обычно выбрасывают, а из других крупных перьев обычно хозяйки делают кисточки для мазания выпечки. Мягкий, пушистый пух используется для изготовления подушек, одеял или курток. Перья следует дергать резким движением, захватывая немного, чтобы при этом не порвалась кожа. Гуся надо держать на коленях хвостом к таре и ощипывать пух по направлению его роста. Последовательность ощипывания гусиной тушки у каждого своя: обычно начинают со стороны груди, потом переходят на спину, хвост и шею. Перья и пух на локтевом сгибе и шее остаются. Для того чтобы довести ощипывание до конца, по очереди эти части опускают в кипящую воду и держат 1-2 минуты. После чего пух отходит очень легко.

Холодный способ ощипывания гусей

При этом способе гуся в течение 3-4 часов подвергают охлаждению, тогда происходит уплотнение жировых отложений, находящихся под кожей. В теплом виде кожа иногда разрывается при ощипывании сухим способом, и вид тушки портится.

За это время легкоплавкий подкожный жир застывает, и перья выдергиваются намного легче, кожа гуся почти не травмируется. Многие охотники знают, как ощипать гуся в полевых условиях, и холодный способ для них более приемлемый.

Ощипывание домашнего гуся ошпариванием

Этот способ отличается от сухого тем, что при этом пух гуся легко выщипывается и не разлетается по помещению. После ошпаривания перья и пух становятся чистыми, это важно, когда планируется использовать их для подушек и перин. Перед началом надо приготовить горячую воду с температурой 80-90 градусов и сделать так, чтобы она не остывала, если требуется чистить не только одного гуся. Как ощипать этим способом?

Готового гуся следует взять за лапки и опустить в кипяток на несколько минут. Здесь придется соблюдать технику безопасности, чтобы не обжечься горячей водой или паром от кипятка. Ошпаренного гуся откидывают на большой поднос и аккуратно ощипывают, убирая пеньки.

Ощипывание гуся с помощью утюга

Придуман еще один способ ощипывания гуся - это обработка тушки горячим утюгом. Как лучше ощипать гуся с помощью горячего утюга, знают опытные хозяйки. Для этого берут хлопчатобумажную тряпку, сложенную в несколько слоев, намачивают ее и прикладывают постепенно к разным частям тушки, делая движения, как при глажке белья. Тряпку по мере необходимости намачивают несколько раз и перекладывают, пока не прогладится вся тушка гуся. Перья и пух получаются при таком способе чистыми, пух не разлетается по помещению и не садится на одежду, которую трудно очистить от налипшего пуха.

Можно ли ощипать гуся с помощью электроинструментов?

При описанных выше способах ощипывания домашней птицы затрачивается много усилий и времени, если у человека нет определенных навыков. Продвинутые люди долго не ломали голову над вопросом, как ощипать гуся, и придумали способ выполнения этой процедуры, прибегнув к помощи электроинструментов в виде дрели или шуруповерта, которые сейчас имеются почти в каждом хозяйстве. В специализированных магазинах продается специальная и дичи, с помощью которой упрощается процесс избавления от перьев в домашних условиях. При этом пух и перья удаляются с шеи и туловища, локтей и лапок быстро, без усилий. Но есть недостаток этого способа: мягкие пушинки и перо снимаются вместе, без разбора, приходится потом делать их сортировку вручную.

Плюсом является то, что не придется возиться с приготовлением кипятка, утюга, тем более эти способы являются очень трудоемкими и небезопасными. Так что проблему, как легко ощипать гуся, можно решить рационально.

Опаливание волосков и пеньков тушки гуся

Вот и разобрались с известными способами ощипывания гуся.

При любом способе ощипывания после удаления перьев тушка гуся опаливается над огнем газовой плиты, во время которого все мелкие торчащие грубые пушинки, волоски убираются. Если газовой плиты нет, можно это сделать с помощью газовой горелки, паяльника. На худой конец, если нет таких инструментов под рукой, то можно опаливать тушку под огнем лучины, бумаги или пучка соломы. Но после них на влажной коже гуся могут остаться следы копоти. Тогда рекомендуется взять отруби или муку и натереть ими кожу гуся. После этого чистой сухой тряпкой следует удалить остатки муки и отрубей. Мясо от такой процедуры приобретет пикантный вкус. При опаливании надо расправить кожу, чтобы убрать складки на ней, уделить особое внимание местам «под мышками» и на локтевых сгибах - растягивая их, держать над огнем газовой или Опаливание надо проводить осторожно, чтобы не повредить кожу и не растопить жир под кожей птицы.

Ну что же, с помощью этих советов можно легко усвоить правила, как ощипать гуся, и потом их с успехом применять на практике.

Как чистить уток

Чистка уток - легкая, но необходимая часть охоты на уток. Правильное выполнение работы - лучший способ убедиться, что ваш следующий ужин с уткой будет таким, каким он должен быть. Если вы последуете этим советам, вся тяжелая работа, которую вы вложили в отстрел уток, окупится.

При температуре выше 50 градусов неплохо переодевать уток в шторы. Немедленное удаление внутренностей поможет немедленно охладить температуру тела. Сделайте небольшой надрез у основания грудной пластины и удалите все внутренние органы.Если вам нравятся сердце и печень, возьмите с собой небольшой полиэтиленовый пакет, чтобы хранить их отдельно. После того, как птицы оделись в полевых условиях, набейте их сухой бумажной салфеткой и повесьте в тени.

В соответствии с федеральными правилами при транспортировке требуется голова или крыло. Если вы путешествуете на большие расстояния, обледенение птиц обязательно. Но вы не можете просто бросить птиц в холодильник. Когда лед растает, вода испортит мясо. Поместите каждую птицу в пакет с замком на молнии, прежде чем помещать ее в лед.Вам также нужно будет пометить каждую сумку своим именем, видом и полом утки и днем ​​сбора урожая.

Когда вы вернетесь домой, вы можете либо грудью, либо ощипать уток. Разбить довольно просто. Используйте нож для филе, чтобы снять кожицу с мяса грудки, затем аккуратно отделите мясо от грудки. Если вы хотите запекать целую птицу, ее необходимо ощипать.

Выщипывание перьев насухо возможно, но сложно. Лучший способ подготовить утку к ощипыванию - окунуть ее в кипящую воду и парафиновый воск.Мыло для посуды тоже хорошо работает. Пропановая фритюрница для индейки служит отличным горшком для окунания. Раньше мы использовали нижнюю треть бочки объемом 55 галлонов. Просто поставьте барабан на шлакоблоки и разожгите под ним огонь. Держите птицу за ноги или за шею и окуните ее в воду примерно на десять секунд. Перья сразу сотрутся. После удаления перьев опалите волосы с кожи и отрежьте ступни, голову и крылья.

Последний шаг - полоскание полости тела, чтобы очистить все оставшиеся внутренности.Обычно я делаю это на улице с помощью форсунки на садовом шланге. Не замачивайте уток в соленой воде. Это позволит полностью избавиться от аромата мяса. Если вы планируете съесть птицу в течение следующих трех-четырех дней, храните ее в холодильнике. Если нет, упакуйте его для замораживания.

Лучше всего подойдет вакуумный упаковщик. В противном случае заверните птиц в бумагу для замораживания, заклеенную упаковочной лентой. Я обычно кладу завернутых в морозильную камеру птиц в морозильную сумку с замком на молнии для дополнительной защиты. Утки могут храниться до года при постоянной температуре.Но рекомендую есть их в течение полугода.

Как водные птицы, мы упорно работаем, чтобы наша дичь пропала зря. Эти действия помогут вам приготовить вкусные блюда даже после окончания сезона.

Лучший способ поймать дикую утку

Я застрелил свою первую утку, когда мне было 8 или 9 лет. Я сидел в лодке для уток с дедом и старым дробовиком .410. Было раннее утро, и мы наблюдали, как кряква приземляется в ловушках и плавает вокруг, что казалось вечностью.Когда дедушка сказал мне, что пора стрелять, я встал, собрался и выстрелил. Вот и все - я подстрелил свою первую утку и не мог быть более счастливым. Потом мы вернулись домой, и мне сказали, что мне нужно почистить эту утку. Там дедушка передал меня бабушке, и она провела меня через весь процесс.

Бабушка заставила меня выщипывать все перья и показала, как тянуть против волокон, чтобы они немного легче выходили. Пока я ощипывал утку, она заставляла кипятить большую кастрюлю с водой.Затем она добавила в воду пару больших кусков воска, и, когда у меня было достаточно перьев, она показала мне, как окунуть утку и покрыть ее воском. Даем ему остыть и застыть, затем счищаем весь воск и вуаля: идеально очищенная утка. Похоже на то, что можно купить в продуктовом магазине. Никогда не забуду ту первую утку: бабушка приготовила ее специально для меня и приготовила «Утка в апельсине». Это была чудесная утка, я бы хотел вспомнить, насколько она прекрасна на вкус, но все, что я могу вспомнить, - это есть каждый последний кусочек этой утки.

К сожалению, я действительно хорошо почистил эту утку, и с этого момента работа по чистке уток была возложена на меня. Мой папа всегда говорил: «Вы делаете такую ​​отличную работу, вам действительно стоит сделать их все». Я был не против чистить уток, и, в конце концов, это был ценный навык, которому нужно было научиться. За эти годы я испробовал несколько разных методов - всегда ищу способ проще или быстрее. И я узнал, что нет более эффективного метода чистки уток, чем воск.Даже молодые утки со всеми этими булавочными перьями - большинство из них можно вывести с помощью воска.

Процесс довольно простой, хотя может занять много времени. Вот как:

уток

Поставьте большую кастрюлю с водой на плиту и доведите до кипения, затем добавьте около ½ фунта воска на 6 уток. Пока все ждет закипания, начинайте ощипывать уток. Лучше всего держать их за ноги и отрывать от себя.

Как только вы уберете большую часть перьев с тела, крыльев и шеи, вы можете отрезать крылья и шею.Оставьте ноги, чтобы вам было за что держаться.

Окуните утку в воск. Вы должны быть довольно быстрыми с соусом - вы не хотите готовить утку, просто вымойте ее. Поставьте рядом ведро емкостью 5 галлонов с ледяной водой, чтобы птица не замерзла.

Быстро окуните воск, а затем ледяную воду, чтобы воск затвердел. Я люблю окунать утку 6-8 раз, чтобы получить хороший твердый слой воска. Как только воск застынет и затвердеет, вы можете начать его снимать. Это удалит все те маленькие перья и волоски, которые нельзя удалить простым ощипыванием.Когда вы закончите воск, вы можете сделать разрез внизу груди, чтобы добраться до внутренних органов и выпотрошить птицу. Вы можете выбросить этот материал или сохранить его и использовать. Я люблю есть всю печень, сердце и желудок.

уток

Итак, каких уток ощипать целиком, а каких оставить в покое? Я люблю ощипать как можно больше уток целиком. Есть некоторые птицы, которых я просто вырублю грудью - в основном это зависит от того, как они были подстрелены.Любая утка, в которой есть всего несколько гранул, получит полное ощипывание. Иногда встречаются утки, которые ловят всю группу выстрелов, и попытаться ощипать их, не сорвав шкуру, практически невозможно. Это птицы, которых я вырву на грудь.

Один из альтернативных методов, который, как я обнаружил, действительно хорошо работает с утками в конце сезона, - это клейкая лента. Утиную утку с полным оперением и без раздражающих маленьких перьев можно ощипать целиком. Затем я беру изоленту и обматываю ею руку липкой стороной наружу.Все, что вам нужно сделать, это натереть утку лентой, и она удалит большую часть оставшихся перьев. Затем я провожу по нему фонариком, чтобы сжечь оставшиеся волосы и перья, которые не оторвались. Он не так эффективен, как воск, но он неплохо справляется со своей задачей и будет работать, если у вас нет воска.

уток

Последнее, что осталось сделать, это снять ножки. Это может быть так же просто, как отрезать ножницы. Мой предпочтительный метод. На суставе на конце голени сделайте неглубокий надрез по всей длине ноги.Затем сломайте сустав и изо всех сил потяните его. Это вытянет часть сухожилий из ног и сделает их менее трудными для употребления в пищу.

Следите за рецептом, что делать с уткой целиком.

Как почистить утку / Как ... / Советы и методы / Охотник / Образование / Услуги / KDWP

Уведомление

Ваша безопасность - наш приоритет. На объектах KDWP, где разрешено пешеходное движение, практикуйте социальное дистанцирование и соблюдайте все меры безопасности, принятые персоналом. Спасибо.

Для получения последней информации об объектах и ​​услугах KDWP посетите https://ksoutdoors.com/KDWP-COVID-19-Updates.

Для получения последней информации о COVID-19 посетите http://www.kdheks.gov/coronavirus/index.htm.

Вот один из способов начать готовить уток к столу.

Необходимое оборудование: крепкие кухонные ножницы или ножницы для дичи и филейный нож.

На всех этапах процесса старайтесь не порезаться об острые края сломанных костей.

Отрежьте крылья как можно ближе к стыку крыльев.

Начиная с верхней части груди, начинайте выщипывать перья только с груди.

Выщипывайте грудку, как показано.

Ножом для филе сделайте небольшой надрез на коже прямо над грудиной.

Возьмитесь за кожу в месте разреза и потяните ее вниз и назад, обнажая грудку.

Разрежьте «желаемую» кость от сустава крыла до грудины на глубину до кости под грудью.

Обрежьте грудину так, чтобы нож повторял контур кости, пока мясо не освободится от кости.Этот разрез аналогичен разделке при разделке рыбы.

Обрежьте филе от кожи и других соединительных тканей.

Снимите филе с тушки.

Из каждой утки получится два вкусных филе, готовых по вашему любимому рецепту.

Официальный веб-сайт Департамента дикой природы и парков Канзаса

Split Reed Исходное содержание.All Things Waterfowl

Почему мы вешаем / выдерживаем водоплавающих птиц? Текстура и аромат. Со временем природные ферменты разрушают ткань и смягчают ее, а также придают мясу пикантный и приятный аромат! Оптимальная температура для этого ИМО - от 35 до 45 градусов (хотя некоторые говорят, что 35-50!). При температуре выше 44 градусов и в зависимости от времени года следует принимать во внимание опасения по поводу нежелательного роста бактерий, а также мух и других насекомых. Между 35-40 градусами рост бактерий существенно замедляется, чтобы уменьшить потребность в беспокойстве, или практически прекращается.Кроме того, в этом температурном диапазоне большинство насекомых недостаточно активны, чтобы беспокоить ваших птиц. Мне нравится срок выдержки 3-5 дней, но некоторые могут длиться до 7-10 дней в зависимости от птицы и условий старения. Выщипывание также проходит лучше после нескольких дней старения и позволяет жиру / коже снять напряжение с перьев.

Итак, преимущества выдержки утки теперь заключаются в следующем:

  • Нет необходимости возвращаться к работе после того, как вы вернулись с охоты.

  • Улучшение вкусового профиля.Разрушение того, что делает мякоть утки такой темной, является ключом к очень желаемому вкусу у водоплавающих птиц.

  • Текстура старых более жестких птиц снова улучшена.

  • Более легкое ощипывание.

При рассмотрении моего метода выдержки / подвешивания уток вкус и текстура имеют первостепенное значение при принятии решений. Например, если у вас есть птица с дырочками в груди, велика вероятность того, что мясо вокруг ран разложится (налит кровью), а внутренности будут повреждены в результате травмы от гранул (выстрел в кишку).С этими птицами следует обращаться после охоты, так как раневые каналы необходимо очистить, а взорванный кишечник не принесет ничего хорошего для вкуса и, вероятно, заставит вас пожелать, чтобы вы хотя бы проглотили его, пока оно не стало напуганным.

Если птице выстрелили в голову и или только в пару дыр в верхней части туловища, эту птицу хорошо повесить / состарить. Живя в Дакоте и Фронт-хребте Колорадо, я всегда просто вывешивал птиц на улице, когда для этого было подходящее время, или вешал в гараже.В случае необходимости (подумайте о начале сезона) я засуну птичек в холодильник (хотя на вас могут накричать, если вы не такой счастливый холостяк, который живет один, как я!).

Если я вешаю птицу, мне нравится вешать ее за голову / шею, чтобы жидкость стекала в полость и подальше от мяса, хотя для непродолжительного процесса старения (чирок или голубь занимает 1-3 дня) висит на подвешенном состоянии. ноги в порядке.

Измененная микробиота кишечника при парвовирусной инфекции утиного происхождения у утят вишневой долины связана с дисфункцией слизистого барьера. ), для которого характерны атрофия клюва и синдром карликовости.Его основные симптомы - стойкая диарея, дисплазия скелета и задержка роста. Однако патогенез уток Черри-Вэлли, инфицированных D-GPV, до конца не изучен. Чтобы оценить распределение D-GPV в кишечном тракте, морфологическое развитие кишечника, кишечную проницаемость, воспалительные цитокины у уток Cherry Valley и экспрессию белка плотного соединения, инфекцию D-GPV вводили внутримышечно. Технология секвенирования Illumina MiSeq была использована для анализа разнообразия и структуры флоры подвздошной кишки и содержания короткоцепочечных жирных кислот ее метаболитов.Изучение взаимосвязи между изменениями кишечной флоры и функцией кишечного барьера после заражения D-GPV у уток Cherry Valley имеет большое теоретическое и практическое значение для дальнейшего понимания патогенеза D-GPV и структуры кишечной флоры у уток. Результаты показали, что инфекция D-GPV сопровождалась воспалением кишечника и дисфункцией барьера. В это время уменьшение большого количества полезных бактерий и содержания короткоцепочечных жирных кислот в кишечной флоре привело к ослаблению колонизационной устойчивости кишечной флоры и накоплению потенциально патогенных бактерий, что усугубило бы негативный эффект. поражения кишечного тракта D-GPV.Кроме того, значительное увеличение

Unclassified_S24-7 и уменьшение Streptococcus наблюдалось при персистирующем D-GPV, что указывает на нарушение структуры микробиоты кишечника. Примечательно, что изменение микробиоты было связано с транскрипцией белка плотных контактов и иммунных цитокинов. Эти результаты показывают, что измененная микробиота подвздошной кишки, кишечный барьер и иммунная дисфункция связаны с инфекцией D-GPV. Следовательно, существует взаимосвязь между дисфункцией кишечного барьера и дисбактериозом, вызванным D-GPV, но конкретный механизм требует дальнейшего изучения.

Ключевые слова

D-GPV

микробиом кишечника

дисфункция кишечного барьера

иммунная дисфункция

Рекомендуемые статьиЦитирующие статьи (0)

© 2021 Авторы. Опубликовано Elsevier Inc. от имени Poultry Science Association Inc.

Рекомендованные статьи

Цитирование статей

Защитники природы хлопают кишечником хромой утки для защиты мигрирующих птиц

«Это может отсрочить полезные шаги, которые администрация Байдена могла бы предпринять быстрее, если бы этих откатов не произошло», - сказал Ревес.

Представители администрации Трампа говорят, что откат к первоначальному замыслу закона станет благом для землевладельцев и работников отрасли, которых ошибочно считают ответственными за случайную гибель перелетных птиц.

«Это правило просто подтверждает первоначальное значение и намерение Закона о перелетных птицах, разъясняя, что Служба рыбного хозяйства и дикой природы США не будет преследовать землевладельцев, представителей промышленности и других лиц за случайное убийство перелетной птицы», - заявил уходящий в отставку министр внутренних дел Дэвид. Бернхардт в заявлении.

Неистовые защитники окружающей среды говорят, что это изменение в последнюю минуту является явной раздачей нефтегазовой отрасли за счет набора исчезающих видов, что оказывает влияние на все виды птиц в Северной Америке и окружающую среду в целом.

«Это устраняет защиту для каждой птицы в этой стране», - сказал Эрик Шнайдер, политический менеджер Национального общества одюбонов. «Мы теряем время, которого нет у птиц».

По оценкам Общества Одюбона, с 1970 года популяции птиц в США сократились на 3 миллиарда.Организация заявляет, что федеральное правительство должно делать больше для защиты птиц, а не меньше.

Решение

Fish and Wildlife поступило в тот же день, когда Агентство по охране окружающей среды США завершило разработку правил, запрещающих агентству учитывать определенные научные исследования при разработке правил общественного здравоохранения.

Полночные правила, как их называют, когда уходящая администрация проталкивает новые правила, покидая свой пост, потребуют усилий от администрации Байдена, чтобы их отменить.

В то время как большинство президентских администраций занимаются установлением правил в полночь, Ревес говорит, что масштабы и характер усилий администрации Трампа уникальны.

«Сочетание объема и пагубности совершенно беспрецедентно», - сказал он. Защитники дикой природы призвали новую администрацию Байдена не только отменить откат регулирования, но и сделать его более сильным и более способным противостоять будущим попыткам ослабить правила.

«Через суды, Конгресс и административные меры крайне важно, чтобы мы сделали все возможное, чтобы не только восстановить полную защиту Закона о перелетных птицах, но и защитить его от подобных атак в будущем», - сказала Сара Гринбергер. с Национальным обществом Одюбона.Организация призвала администрацию Байдена восстановить правила и убедить Конгресс их усилить.

Администрация Трампа неоднократно утверждала, что меры защиты, предусмотренные в первоначальном законе, применяются исключительно к действиям, которые преднамеренно убивают птиц, и не должны применяться к действиям, которые случайно подвергают опасности птиц, таким как случайные разливы нефти.

В августе этого года федеральный судья недвусмысленно отверг это обоснование и установил, что Закон о договорах о перелетных птицах применяется ко всем действиям, которые приводят к гибели перелетных птиц.

«В тексте закона MBTA нет ничего, что предполагало бы, что для того, чтобы подпадать под его запрет, деятельность должна быть направлена ​​конкретно против птиц», - заявила судья окружного суда США Валери Капрони в постановлении на 31 странице, вынесенном 11 августа. «Закон также не запрещает только преднамеренное убийство перелетных птиц. И уж точно не говорится, что запрещены только «некоторые» убийства ».

Администрация Трампа обжаловала это решение. Но его репутация по противодействию судебным искам в его стремлении отменить экологические нормы оставляет желать лучшего.

«Администрация Трампа проиграла 83% случаев, когда она пыталась отменить экологические нормы во многих случаях из-за плохого анализа и обоснования», - сказал Ревес.

«Это ужасный рекорд, и вполне вероятно, что суд отклонит и эту попытку».

Сравнение кишечного микробного сообщества у уток, выращиваемых по-разному с помощью высокопроизводительного секвенирования

Птицы являются важным источником фекального загрязнения окружающей среды.Многие болезни передаются через загрязнение воды птичьим пометом. Было проведено исследование для сравнения микробной структуры кишечника уток Шаосин с водой и без воды. Тридцать однодневных уток Шаосин (Qingke No. 3) случайным образом разделили на две группы; одна группа имела свободный доступ к воде (CC), в то время как другая была ограничена в доступе к воде (CT). После 8 месяцев разведения образцы слепой кишки 10 птиц из каждой группы были получены на льду для высокопроизводительного секвенирования. Всего было исследовано 1507978 действительных последовательностей и сгруппировано в 1815 операционных таксономических единиц (OTU).На уровне филума в микробном сообществе птиц CC преобладают Firmicutes (41,37%), Bacteroidetes (33,26%), Proteobacteria (13,67%) и Actinobacteria (8,26%), тогда как Firmicutes (53,62%), Bacteroidetes (33,06%). ), и актинобактерии (11,13%) были обнаружены как первичный тип у СТ-уток. На уровне рода Bacteroides (25,02%), Escherichia-Shigella (11,02%), Peptococcus (7,73%) и Parabacteroides (5,86%) были выявлены в основном родами уток группы CC, тогда как Bacteroides (18.11%), Erysipelatoclostridium (10,94%), Ruminococcaceae_unclassified (10,43%), Lachnospiraceae_unclassified (5,26%), Coriobacteriales_unclassified (5,89%) и Faecalibacterium (4,2%) были обнаружены в составе микробной флоры птиц. Было обнаружено, что один тип и 13 родов имеют значительную разницу между двумя группами птиц (p <0,05). На уровне филума было обнаружено, что протеобактерии у CT-уток явно ниже, чем у уток у CC-птиц (p <0,05). На уровне рода Escherichia-Shigella (p <0.05) и Peptococcus (p <0,05) были значительно ниже у CT птиц, в то время как Erysipelatoclostridium (p <0,05), Ruminococcaceae_unclassified (p <0,01), Coriobacteriales_unclassified (p <0,05), Faecalibacterium (p <0,01), Atocalibacterium (p <0,01), Atopoassbia p <0,01), Alistipes (p <0,05), Eggerthellaceae_unclassified (p <0,05), Prevotella_7 (<0,05), Rikenellaceae_RC9_gut_group (p <0,05), Prevotellaceae_uncultured (p <0,05) и Shuttleworthia (p <0,05) и Shuttleworthia (p <0,05). заметно выше у CT уток.В заключение, настоящее исследование выявило эффекты удержания уток от плавания с очевидными изменениями в микробном сообществе. Хотя более высокое микробное богатство было обнаружено у уток, не умеющих плавать, более патогенные роды, включая Eggerthella, Erysipelatoclostridium, Alistipes, Prevotella_7 и Shuttleworthia; зоонозные роды, включая Eggerthella и Shuttleworthia; воспалительный род Alistipes; противовоспалительное средство рода Faecalibacterium; и опухолевый род Rikenellaceae были исследованы на этих утках.CT-утки также показали значительные изменения на уровне родов в отношении метаболизма (Peptococcus, Ruminococcaceae и Coriobacteriales).

1. Введение

Птица имеет большое значение для хозяйствования и размещения людей. Домашняя птица в Китае составляет около 25% мирового населения и примерно 40% домашней птицы в Азии [1]. В Китае разводят четыре распространенных вида уток: утку гаою, утку по-пекински, утку шаосин и вэйшань-шелдрейк. Эти утки вносят большой вклад в развитие птицеводства Китая.Утки Шаосин обычно разводятся более чем в 10 провинциях страны. Однако неизбежное загрязнение воды этими утками всегда доставляло беспокойство местному населению [2]. Держать птиц подальше от воды для купания кажется действительно эффективным и нетребовательным методом борьбы с загрязнением воды.

Сложное микробное сообщество человека и животных состоит из более чем тысяч микробных родов [2]. Эти многочисленные микроорганизмы имеют большое значение для защиты желудочно-кишечной системы, синтеза и метаболизма частей NHV (питательных веществ, гормонов и витаминов), устранения лекарств и токсичных метаболитов, индукции и регулирования реакции хозяина на различные патогены, защиты от патогенов, и помогает в развитии и созревании иммунных клеток [3–7].Установлено, что изменения или нарушения микробной флоры связаны с различными заболеваниями желудочно-кишечного тракта, которые могут вызывать нарушение пищеварения, снижение прибавки в весе и даже приводить к смерти животных [5]. Инфекционные заболевания могут стать причиной серьезных бедствий для здоровья и продуктивности животных в развивающихся странах [8–10]. Однако имеется скудная информация о том, что вынимание уток из водоема оказывает влияние на микробное сообщество птиц. Поэтому мы выполнили это исследование, чтобы выявить изменения микробного сообщества, сравнив микробную структуру уток Шаосин с водой и без воды для плавания с помощью высокопроизводительного секвенирования.

2. Материалы и методы
2.1. Этика

Все эксперименты и процедуры на животных проводились в соответствии с соответствующими процедурами Прокламации Постоянного комитета Колледжа наук о животных, Вэньчжоуский профессиональный колледж науки и технологий, Вэньчжоу, Китайская Народная Республика.

2.2. Выращивание птиц и отбор образцов Caeca

В текущем исследовании в общей сложности 30 однодневных уток шаосин (Qingke No. 3) были выращены и выращены на местной утиной ферме в округе Цаннань, Вэньчжоу, Китай.Утки были случайным образом разделены на две группы (CC и CT) (рис. 1). Утки в группе CC (CC1-CC10) и группе CT (CT1-CT10) были выведены с использованием коммерческого рациона и обычной питьевой воды, как сообщалось ранее [11]. Птицы в группе CC имели свободный доступ к воде для купания, в то время как утки в группе CT содержались без воды. После 8 месяцев разведения были взяты по 10 образцов слепой кишки из каждой группы и немедленно заморожены в жидком азоте. Все образцы хранили при -80 ° C для дальнейшего анализа.


2.3. Выделение ДНК и амплификация гена

Микробную геномную ДНК из каждого образца утки выделяли с использованием коммерческих мини-наборов QIAamp® Fast DNA (Qiagen Ltd., Германия) в соответствии со спецификацией производителя, как описано в предыдущем исследовании [4]. Ген 16S рРНК (вариабельная область V3-V4) амплифицировали с праймерами (F: ACTCCTACGGGAGGCAGCAG и R: GGACTACHVGGGTWTCTAAT) [12]. Смесь для ПЦР, включающая 18 мкл автоклавированной дистиллированной воды, 10 мкл буфера для ПЦР (5 ×), 4.5 мкл dNTP (2,5 мМ), 10 мкл буфера для ГХ (5 ×), 4 мкл ДНК-матрицы, 0,5 мкл Taq E и 1,5 мкл каждого прямого и обратного праймера (рабочая концентрация: 10 мкМ) в реакционном объеме 50 мкл. готовый. Каждый из 35 циклов ПЦР состоял из 98 ° C в течение 15 секунд, 55 ° C в течение 30 секунд и 72 ° C в течение 27 секунд после начального горячего старта при 98 ° C в течение 3 минут и заканчивая 72 ° C в течение 10 минут. Все существующие продукты амплификации ДНК исследовали в 1,5% агарозном геле, окрашенном бромидом этидия; Полосы ДНК выделяли с использованием набора для восстановления геля ДНК AxyPrep (Axygen Biosciences, США).

2.4. Подготовка и секвенирование библиотеки
Библиотеки

были созданы с использованием комплекта NEB Next Ultra DNA Library Prep Kit для Illumina (NEB, США) в соответствии с пояснительной запиской, и индексные коды были добавлены, как описано в предыдущем исследовании [6, 13]. Все продукты библиотеки были количественно определены с использованием флуориметра Qubit 2.0 (Thermo Fisher Scientific, США). Затем все библиотеки амплификации были секвенированы посредством высокопроизводительного секвенирования на платформе Illumina MiSeq (Illumina, Сан-Диего, США).

2,5. Биоинформатика и статистический анализ

Количественный анализ микробной экологии (QIIME, v1.8.0) использовался для удаления последовательностей ошибок или вопросов в текущем исследовании [14]. Операционные таксономические единицы (OTU) были получены с помощью USEARCH (версия 7.1 http://drive5.com/uparse/) на основе 97% сходства и удаления кластеризации дивергентных последовательностей (<3%) [6, 15]. OTU были таксономически проанализированы с помощью инструмента BLASTn в соответствии с тщательно подобранной базой данных UNITE [16]. Анализ альфа- и бета-разнообразия был проведен в соответствии с ранее опубликованными исследованиями [4, 6].Микрофлору птиц на уровне типа и рода идентифицировали с помощью QIIME [6]. Тепловые карты были разработаны на основе «gplots» пакета R [4]. PCA (анализ главных компонентов), PCoA (анализ главных координат), NMDS (неметрическое многомерное масштабирование), LEfSe (размер эффекта линейного дискриминантного анализа) и LDA (анализ линейной дискриминации) были выполнены в соответствии с предыдущими исследовательскими отчетами [17–19] . Чтобы обнаружить различия между группами уток на разных уровнях, был использован односторонний дисперсионный анализ, за ​​которым последовал честный тест Тьюки для непрерывных переменных, и различия считались статистически значимыми при p <0.05 через IBM SPSS Statistics 24.0 (SPSS Somers, NY).

3. Результаты
3.1. Разнообразие микробного сообщества уток в разных группах

Всего было исследовано 1507978 действительных последовательностей с 99,92% последовательностей длиной 381-400 п.н. (рис. 2 (а)). Все эти последовательности были сгруппированы в 892 и 923 OTU, соответственно, в группах CC и CT. Всего 748 OTU были разделены на две группы (рисунок 2 (b)). Кривая накопления видов оказалась чрезвычайно горизонтальной, когда количество образцов достигло 20, что показало, что выбранные образцы в текущем исследовании были приемлемыми (рис. 3 (а)).Все значения охвата были чрезвычайно близки к 1,00, что свидетельствует о значительном количестве библиотек, обнаруженных в каждой утке (Таблица 1). Кривые рангового обилия различных указанных птиц представляли собой длинную и гладкую прерывистую линию, указывающую на высокую численность и равномерное распределение видов птиц (рис. 3 (b)) [6]. Низкие значения кривых Симпсона и горизонтальных ломаных кривых Шеннона выявили высокое разнообразие этих уток (Таблица 1; Рисунок 3 (c)). Индекс богатства сообщества различных образцов уток Chao и ACE показал высокое богатство микробной флоры в каждой утке с кривыми постепенного разрежения, характерными для птиц (Таблица 1; Рисунок 3 (d)).

Шао Simpson CC 9034
Структура микробного сообщества на разных уровнях в разных группах уток

На уровне филума было обнаружено, что на уровне филума в микробном сообществе доминируют Firmicutes (41,37%), Bacteroidetes (33,26%), Proteobacteria (13,67%) и Actinobacteria (8,26%). птицы CC, а Firmicutes (53.62%), Bacteroidetes (33,06%) и Actinobacteria (11,13%) оказались основными типами у СТ-уток (рис. 5). На уровне родов основными родами уток группы СС были Bacteroides (25,02%), Escherichia-Shigella (11,02%), Peptococcus (7,73%) и Parabacteroides (5,86%), тогда как Bacteroides (18,11%), Erysipelatoclostridium (10,94%), Ruminococcaceae_unclassified (10,43%), Lachnospiraceae_unclassified (5,26%), Coriobacteriales_unclassified (5,89%) и Faecalibacterium (4,2%) были обнаружены в качестве основных компонентов микробной флоры у CT птиц (Рисунок 6).

3.3. Сравнение структуры микробного сообщества в разных группах птиц

Четкое различие между CC и CT уткой было выявлено на столбчатой ​​диаграмме микробного сообщества с кластерным деревом, рассчитанным с использованием Брея-Кертиса (коэффициент расстояния Брея-Кертиса Брея-Кертиса) (рис. ) [20]. Результаты PCA, PCoA и NMDS показали отчетливый сдвиг микробной структуры между двумя группами (рис. 8). Используя анализ Metastats, было обнаружено, что 1 тип и 13 родов имеют существенные различия между двумя группами птиц.На уровне филума было обнаружено, что протеобактерии у CT-уток явно ниже, чем у уток у CC-птиц (p = 0,0167 <0,05) (рис. 9). На уровне рода было обнаружено, что Escherichia-Shigella (p = 0,0364) и Peptococcus (p = 0,0429) значительно ниже у CT птиц (p <0,05), в то время как Erysipelatoclostridium (P = 0,0407 <0,05), Ruminococcaceae_unclassified (p = 0,0027 < 0,01), Coriobacteriales_unclassified (p = 0,0235 <0,05), Faecalibacterium (p = 0,0014 <0,01), Atopobiaceae_unclassified (p = 0,0093 <0,01), Alistipes (p = 0.014 <0,05), Eggerthellaceae_unclassified (p = 0,0128 <0,05), Prevotella_7 (p = 0,0155 <0,05), Rikenellaceae_RC9_gut_group (p = 0,0385 <0,05), Prevotellaceae_uncultured (p = 0,0345) <0,05) и Shuttleworthia. наблюдались заметно выше у уток CT (Рисунок 10). Тепловая карта в представленных результатах показала очевидное различие типов Proteobacteria в разных группах (рис. 11). Значительная разница также была обнаружена среди родов Klebsiella, Brevibacterium, Bacillus, Lactococcus, Anaerofustis, Bacteroidales_unclassified, Rikenellaceae_RC9_gut_group, Rikenellaceae_unclassified, Ruminococcus_torques_group, Negativibacillus, Blautia, Ruminococcaceae_UCG-005, Ruminococcaceae_UCG-014, Shuttleworthia, Prevotellaceae_uncultured и Faecalibacterium в двух уток групп ( Рисунок 12).При использовании LEfSe (http://huttenhower.sph.harvard.edu/galaxy/root?tool_id=lefse_upload) и LDA (линейный дискриминантный анализ) важный микробиом уток CC был показан красным цветом, в то время как CT птиц был показан зеленым цветом (Рисунок 13). Очевидное различие важных микроорганизмов было обнаружено несоответствием красного и зеленого цветов между двумя группами.

4. Обсуждение

В Китае ежегодно выращивается более 10 миллиардов домашней птицы (Национальное статистическое бюро Китая, (http: // data.stats.gov.cn/adv.htm?m=advquery&cn=C01) отмечают большой вклад в экономическое и продовольственное обеспечение страны. Такое удивительное количество птиц ставит под вопрос качество воды для потребления человеком.

Ранее было проведено исследование на утках Шаосин, тех же утках, которые использовались в нашем исследовании, в котором описаны изменения микробиоты кишечника, выращенные на подстилке и полу из пластиковой сетки [21]. В текущем исследовании мы использовали секвенирование гена 16S рРНК Illumina HiSeq, чтобы впервые сравнить микробиоту кишечника у CC и CT уток.У каждой утки было обнаружено высокое разнообразие и богатство микробной флоры, что соответствует результатам предыдущих исследований [4, 6]. Индекс Шеннона у CT уток был значительно выше, в то время как Симпсон, очевидно, был на более высоком уровне (рис. 4), что могло быть связано с двумя разными статистическими методами, поскольку оба метода касаются разнообразия микробного сообщества [6]. Показано, что индекс Чао заметно выше у СТ-уток (рис. 8), что согласуется с ранее обнаруженным снижением разнообразия микробного сообщества у диарейных собак и оленей [22, 23].Настоящие результаты, возможно, означают, что выведение птиц из воды увеличило богатство микробного сообщества.








Один тип и 13 родов у CT птиц значительно наблюдались у CC уток (рисунки 9 и 10). Среди 13 родов, 2 родов (кишечная-шигеллы и Peptococcus) были обнаружены на гораздо более низком уровне в группе КТ, в то время как 11 родов (Erysipelatoclostridium, Ruminococcaceae_unclassified, Coriobacteriales_unclassified, Faecalibacterium, Atopobiaceae_unclassified, Alistipes, Eggerthellaceae_unclassified, Prevotella_7, Rikenellaceae_RC9_gut_group, Prevotellaceae_uncultured и Shuttleworthia) было показано, что она явно выше у уток CT (Рисунок 9).Было обнаружено, что широко известная Escherichia-Shigella связана с провоспалительным статусом [24], приводящим к воспалению слизистой оболочки толстой кишки [22]. Эти бактериальные патогены в основном передаются с фекалиями, пищей и водой [23, 24]. Роды Eggerthella, Erysipelatoclostridium, Alistipes и Prevotella_7 считались условно-патогенными микроорганизмами [25–27], при этом Eggerthella обладала потенциалом зооноза [26]. Род Shuttleworthia имеет один известный вид, Robinsoniella peoriensis , который первоначально был изолирован от свиней и мог инфицировать иммунокомпетентных людей [28, 29].Из результатов можно сделать вывод, что отказ уток от плавания уменьшил патогенетический род Escherichia-Shigella; однако, очевидно, что в микробном сообществе выросло больше патогенов (Eggerthella, Erysipelatoclostridium, Alistipes, Prevotella_7 и Shuttleworthia). Сообщалось, что род Peptococcus связан с респираторным метаболизмом глюкозы [30, 31]. Ruminococcaceae связаны со способностью разлагать целлюлозу [32]. Кориобактерии способны метаболизировать широкий спектр углеводов и других метаболитов [33].Было обнаружено, что виды Coriobacteriaceae значительно увеличиваются в слепой кишке мышей в ответ на стресс [34]. Эти результаты наводят на мысль, что запрещение уткам плавать может повлиять на метаболизм птиц. Faecalibacterium участвует в противовоспалительной активности кишечника [34, 35], а Alistipes, как было показано, связан с воспалением кишечника [36]. Было обнаружено, что Rikenellaceae выше у больных раком с опухолевым синдромом [37]. Из изменений мы можем обнаружить, что плавание может вызвать изменения воспалительных и противовоспалительных процессов и даже опухолевых механизмов из-за изменений микробной флоры.Из-за недостатка информации об Atopobiaceae и Rikenellaceae нельзя строить предположения о его связи с двумя разными группами [38].

В заключение, настоящее исследование впервые выявило эффекты удержания уток от плавания с очевидными изменениями в микробном сообществе птиц. Хотя более высокое микробное богатство было обнаружено у уток, не умеющих плавать, более патогенетических родов (Eggerthella, Erysipelatoclostridium, Alistipes, Prevotella_7 и Shuttleworthia), даже зоонозных родов (Eggerthella и Shuttleworthia), воспалительных родов (Alistipes), противовоспалительных родов (Faecalibacterium). Роды, родственные опухоли (Rikenellaceae), были исследованы на утках.Также CT уток показали значительные изменения в родах в отношении метаболизма (Peptococcus, Ruminococcaceae и Coriobacteriales). Проведенные здесь исследования могут внести вклад в стратегический процесс, связанный с загрязнением воды в животноводстве, и выделить его.

Доступность данных

Данные, использованные для подтверждения выводов этого исследования, можно получить у соответствующего автора по запросу.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Вклад авторов

Ян Чжао, Кун Ли и Хоуцян Луо внесли равный вклад в это исследование.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *


Группа Образец ID
ACE
1 599 606 0,0274 4,53 0,997910
2 493 492 0.0761 3,47 0,997618
3 199 245 0,0748 2,96 0,998882
4
5 480 481 0,2565 2,05 0,997059
6 428 535 0,1108 2.9 0,997424
7 456 448 0,0807 3,69 0,998226
8 619
619
273 267 0,128 2,61 0,998517
10 516 534 0,0621 3,46 0.997108
CT 1 647 653 0,0242 4,55 0,997594
2 566 678 651 0,0413 4,24 0,997059
4 550 567 0,041 3,98 0.997327
5 461 426 0,0375 4,02 0,998080
6 606 617
705 0,0249 4,55 0,997011
8 451 446 0,0827 3,36 0,997813
0,997813 9024 4,43 0,998056
10 644 640 0,0204 4,65 0,997570

906609